The effect of methyl jasmonate and salicylic acid elicitors on production amount of Glycyrrhizin and Isoliquiritigenin in hairy roots of Licorice (Glycyrrhiza glabra L.)

Document Type : Research Paper

Authors

1 Bu-Ali Sina University

2 Agricultural Biotechnology Research Institute of Iran, Karaj, Iran

3 Medical Science University

Abstract

The effect of salicylic acid and methyl jasmonate elicitors on the growth speed and the secondary metabolites production was investigated in G.glabra hairy roots. Considering the importance of the Glycyrrhizin and Isoliquiritigenin secondary metabolites in the roots of this plant, a method of the induction of transformed hairy roots was used in this study. Hairy roots culture was established by Inoculated leaf and stem explants with Agrobacterium rhizogenes of the three-week old seedlings. The presence of T-DNA in the hairy root lines was performed by PCR. The effect of Salicylic acid was caused an increase in the production of Glycyrrhizin. Correlation of test results showed an inverse relationship between dry weight and amount of Glycyrrhizin in the treatment with salicylic acid. The highest amount of Glycyrrhizin and the lowest dry weight was obtained in 500 micro-molar concentration. Treatment of the hairy roots with salicylic acid was caused a significant decrease in Isoliquiritigenin. Also results showed, methyl jasmonate reduces the production of Glycyrrhizin and Isoliquiritigenin.

Keywords

اثر محرک­های اسید سالیسیلیک و متیل جاسمونات بر میزان تولید ماده مؤثره گلیسیریزین و ایزولیکویریتیجنین در ریشه­های مویین شیرین‌بیان ((Glycyrrhiza glabra L. 

زهرا شیرازی1، خسرو پیری1*، اصغر میرزایی اصل1، طاهره حسنلو2 و طیبه قیاسوند3 

1 همدان، دانشگاه بوعلی سینا، دانشکده کشاورزی، گروه بیوتکنولوژی 

2 کرج، پژوهشکده بیوتکنولوژی کشاورزی ایران، گروه فیزیولوژی مولکولی 

3 همدان، دانشگاه علوم پزشکی، مرکز تحقیقات پزشکی مولکولی

تاریخ دریافت: 13/11/90             تاریخ پذیرش: 11/4/91 

چکیده

در این پژوهش اثر محرک­های اسید سالیسیلیک و متیل جاسمونات روی سرعت رشد و تولید متابولیت­های ثانویه در ریشه­های مویین شیرین‌بیان مورد بررسی قرار گرفت. با توجه به اهمیت متابولیت­های ثانویه گلیسیریزین و ایزولیکویریتیجنین موجود در ریشه­های این گیاه، از روش القاء ریشه­های مویین تراریخت استفاده شد. کشت ریشه­های مویین با تلقیح ریزنمونه­های برگ و ساقه از گیاهچه­های سه هفته­‌ای با آگروباکتریوم ریزوژنز ایجاد شد. حضور T-DNA در لاین­های ریشه مویین توسط PCR تأیید گردید. اثر محرک اسید سالیسیلیک سبب افزایش تولید گلیسیریزین شد. نتایج آزمون همبستگی، رابطه معکوسی بین وزن خشک و مقدار گلیسیریزین را در نتیجه تیمار با اسید سالیسیلیک نشان داد. بیشترین مقدار گلیسیریزین و کمترین مقدار وزن خشک در غلظت 500 میکرومولار حاصل شد .تیمار ریشه­های مویین با اسید سالیسیلیک باعث کاهش معنی­دار ایزولیکویریتیجنین شد. همچنین نتایج نشان داد، استفاده از متیل جاسمونات باعث کاهش تولید گلیسیریزین و ایزولیکویریتیجنین می­شود.

واژه­های کلیدی: شیرین‌بیان، ریشه­های مویین، گلیسیریزین، ایزولیکویریتیجنین، محرک­ها

* نویسنده مسئول، تلفن: 09188130783، پست الکترونیکی   [email protected]

مقدمه

 

شیرین‌بیان ((Glycyrrhiza glabra L. از گیاهان دارویی تیره نخودیان (Fabaceae) می­باشد. اندام مورد مصرف آن ریشه و استولون است که دارای ترکیباتی مانند تری­ترپن­ساپونین­ها، چالکون­ها و 300 نوع فلاونوئید می­باشد (2، 3 و11). بسیاری از اثرات درمانی ریشه شیرین‌بیان بعلت دو گروه از ترکیبات ساپونینی و فلاونوئیدی است (28). استفاده از شیرین‌بیان در اختلالات کبدی حاد، هپاتیت B و C مزمن، هموفیلی و اختلالات سیستم ایمنی مؤثر می­باشد. ترکیب گلیسیریزین در صنایع غذایی و همچنین در درمان اختلالات ریوی، گوارشی، کبدی، صفراوی و زخم­های معده استفاده می­شود (13 و 45). از عصاره آن داروهایی مانند (Aspalon)R و Glycyron)R) تولید می­شود (9، 19 و 28). ایزولیکویریتیجنین چالکونی ساده و پیش ماده تولید ترکیبات فلاونوئیدی است و دارای اثرات استروژنی، آنتی‌اکسیدان، ضد حساسیت و ضد التهاب بوده و به‌عنوان داروی ضد سرطان و مؤثر در درمان آریتمی می‌باشد (18). با توجه به اینکه در طبیعت سرعت تولید متابولیت­های ثانویه کند می­باشد، استفاده از روش­های بیوتکنولوژی در شرایط این ویترو (in vitro) این موقعیت را فراهم می­سازد که تولید در شرایط کنترل شده و در زمان کوتاه­تری انجام گیرد (36 و 44). در برخی از روش­های بیوتکنولوژی مانند کشت سلول و سوسپانسیون سلولی نیز مقدار تولید متابولیت­های ثانویه بدلیل عدم تمایز بافت کم است و برخی از متابولیت­ها فقط در بافت­هایی که تمایز مورفولوژیکی نشان می­دهند، تجمع می­یابند. ازجمله روش­های کشت تمایز یافته، کشت ریشه می­باشد (1 و 8). کشت ریشه بصورت ریشه­های نابجا و ریشه­های تراریخت انجام می­شود (15). سیستم کشت ریشه در گیاهان معمولا سرعت رشد کمتری نشان داده و نیاز به فیتوهورمونی خارجی دارد (4). روش جایگزین برای تولید مواد دارویی با منشأ ریشه، تراریختی گیاهان با استفاده از آگروباکتریوم ریزوژنز و ایجاد سیستم کشت ریشه مویین می‌باشد (17 و 44). این باکتری از محل زخم وارد گیاه شده و با انتقال قطعهT-DNA  پلاسمید Ri به درون ژنوم سلول گیاهی، ریشه­های نئوپلاستیک را در گیاه ایجاد می­کند (14، 16، 40، 43 و 49). سرعت رشد بالا، انشعابات فراوان، نگهداری آسان در محیط عاری از هورمون­های گیاهی، پایداری ژنتیکی و بیوسنتزی از مزایای کشت ریشه­های مویین می­باشد (1، 16، 23، 27 و 40). بدلیل مقدار پایین تولید متابولیت با استفاده از تکنولوژی کشت بافت، از روش­های متعددی برای جبران آن استفاده می­گردد (23). یکی از روش­ها استفاده از محرک­ها (Elicitors) می­باشد که معمولا باعث تسریع در تشکیل متابولیت­های ثانویه می­شوند (35). مکانیسم­های دفاعی گیاه با شناسایی این سیگنال­ها (محرک) بوسیله گیرنده­های موجود در غشای پلاسمایی و تولید ترکیبات اسید جاسمونیک و اسید سالیسیلیک اندوژن فعال می­شود. فعال شدن پاسخ دفاعی سبب سنتز پروتئین­های مرتبط با مکانیسم­های دفاع سلولی و القاء تولید متابولیت­های ثانویه با ایجاد یکسری تغییرات سلولی می­گردد (42). در بیشتر موارد اضافه­کردن محرک­ها در غلظت­های کم به سیستم­های سلولی، بیوسنتز ترکیبات خاصی را تحریک و یا بهبود می­بخشد (32 و 34). با توجه به نوع گیاه و نوع متابولیت مورد نظر، می­توان از عصاره­های استخراج شده از ارگانسیم­ها و یا از برخی مواد شیمیایی به‌عنوان محرک استفاده نمود (12). در این تحقیق از دو محرک متیل جاسمونات و اسید سالیسیلیک به‌منظور بررسی تولید گلیسیریزین، ایزولیکویریتیجنین و سرعت رشد ریشه­های مویین شیرین بیان استفاده شد که این دو محرک در القاء و سنتز متابولیت­های ثانویه ریشه­های تراریخت بسیاری از گونه­های گیاهی مؤثر می­باشند.

مواد و روشها

القاء ریشه­های مویین: بذرهای گیاه شیرین‌بیان از شرکت پاکان بذر اصفهان (منطقه ورزنه اصفهان) تهیه گردید و بذرها به مدت 40 دقیقه در اسید سولفوریک غلیظ (98 در صد) قرار گرفتند، سپس چندین بار با آب مقطر استریل آبکشی شده و پس از آن روی محیط MS (31) نیمه جامد کشت شدند. برای تهیه کشت سوسپانسیون باکتری، از آگروباکتریوم ریزوژنز سویه AR15834 که از پژوهشکده بیوتکنولوژی کشاورزی کرج تهیه گردید، استفاده شد. برای تلقیح ریزنمونه­های بدست آمده از گیاهچه­های یک کلونی از باکتری کشت شده در محیط کشت جامد LB در شرایط استریل برداشته شد (37) و در محیط کشت مایع LB دارای آنتی‌بیوتیک ریفامپسین کشت گردید. در مرحله بعد محیط LB مایع آلوده شده به باکتری به اتاق رشد با دمای °C 28 منتقل شد و روی شیکر با سرعت 110 دور در دقیقه به مدت 24 ساعت در شرایط تاریکی قرار گرفت تا باکتری رشد کرده و فعال شود. برای تراریختی، جذب نوری در طول موج 600 نانومتر حدود 6/0 تنظیم گردید. ریزنمونه­های برگ و ساقه از گیاهچه­های سه هفته­ای به مدت 20 دقیقه در سوسپانسیون باکتری قرار گرفتند، سپس به محیط کشت MS نیمه جامد منتقل شدند و در اتاق رشد در دمای °C 2±25 و و دوره نوری 16 ساعت روشنایی و 8 ساعت تاریکی نگهداری شدند. 48 ساعت بعد از هم‌کشتی برای حذف باکتری، ریزنمونه‌ها به محیط نیمه جامد MS دارای 500 میلی­گرم در لیتر سفوتاکسیم منتقل گردیدند. برای حذف کامل باکتری در واکشت­های بعدی از غلظت­های پائین­تر سفوتاکسیم استفاده گردید. تراریختی ریشه­های مویین را می­توان با ردیابی ژن­های موجود روی T-DNA این باکتری که مهمترین آنها ژن­های rolrolB وrolC  می­باشند، تأیید نمود. تأیید تراریختی ریشه­های مویین شیرین‌بیان از طریق تکنیک PCR و پس از اطمینان از حذف باکتری در ریشه­ها انجام شد. بدین منظور ابتدا استخراج DNA از ریشه­های مویین و طبیعی گیاه با استفاده از بافر استخراج CTAB انجام شد. تکثیر ژن  rolB با آغازگرهای اختصاصی

Forward  primer  5'- ATGGATCCCAAATTGCTATTCCCCACGA -3' 

Reverse  primer  5'- TTAGGCTTC TTTCATTCGGTTTACTGCAGC -3'

و برای 37 چرخه شامل واسرشت در دمای °C 94 به مدت 1 دقیقه، اتصال در دمای °C58 به مدت 1 دقیقه و گسترش در دمای °C 72 به مدت 1 دقیقه انجام شد. در نهایت بعد از تأیید مولکولی ریشه­های مویین یک لاین برای بررسی اثر محرک­ها انتخاب شد.

اثر محرک­ها بر سرعت رشد و محتوای تولید متابولیت­های ثانویه: بعد از تهیه محیط کشت MS مایع، در ارلن­های 250 میلی لیتری به مقدار 50 میلی لیتر از محیط توزیع شد و عمل استقرار ریشه‌های (3-2) سانتی‌متری دارای انشعاب (با وزن خشک حدود 5-4 میلی‌گرم) در محیط مایع انجام گردید. همه نمونه­ها برای ادامه رشد روی شیکر با سرعت 100 دور در دقیقه قرار گرفتند. بعد از پایان دوره 55 روزه، به‌منظور بررسی تأثیر محرک­ها در رشد ریشه­ها و تولید ماده مؤثره گلیسیریزین و ایزولیکویریتیجنین، محرک­های متیل جاسمونات در 4 غلظت (200، 100، 50، 0 میکرو مولار) و اسید سالیسیلیک در 4 غلظت (500، 250، 125، 0 میکرو مولار) به محیط کشت اضافه گردید و ریشه­ها به مدت 72 ساعت در محیط حاوی محرک­ها قرار گرفتند. برای تعیین سرعت رشد ریشه­ها بر اساس وزن خشک تولید شده، ریشه­ها برداشته شده و پس از خشک شدن کامل اندازه­گیری شدند. برای اندازه­گیری گلیسیریزین و ایزولیکویریتیجنین ابتدا ریشه­ها به روش هایاشی و همکاران (21) عصاره­گیری شدند و بررسی کمی به وسیله دستگاه HPLC انجام شد. کلیه نتایج در قالب طرح کاملا تصادفی با سه تکرار و توسط نرم‌افزار SPSS نسخه 16 آنالیز شد. استاندارد گلیسیریزین از شرکت فلوکا و ایزولیکویریتیجنین از شرکت ایندو فاین تهیه گردید. نمونه­ها برای اندازه­گیری گلیسیریزین به روش هارست و همکاران (24) بعد از حل شدن در آب مقطر به دستگاه  HPLCبا مشخصات ستون ( mm9/3×150) RPC18، اندازه منافذ 5 میکرومتر و فاز متحرک شامل اسید استیک، آب و متانول به‌ترتیب به نسبت 6: 34 :60 انجام شد. برای ایزولیکویریتیجنین به روش لیو و همکاران (29) بعد از حل شدن در متانول 100 درصد به دستگاه با مشخصات ستون ( mm6/4×250RPC18 (، اندازه منافذ 5 میکرومتر و فاز متحرک شامل اسید استیک (یک درصد) و استونیتریل به نسبت 55 : 45 تزریق شد.

 

شکل1- کشت ریشه­های مویین شیرین بیان در محیط مایع

نتایج  

القاء ریشه­های مویین: گیاه شیرین­بیان با تلقیح به سویهAR15834 باکتری آگروباکتریوم ریزوژنز پاسخ مثبت نشان داد و استفاده از این سویه باعث تولید ریشه­های مویین در ریزنمونه­ها شد. ریشه­های مویین تولید شده از نظر مورفولوژی خصوصیاتی از قبیل رشد سریع، انشعابات فرعی زیاد در محیط فاقد هورمون را از خود بروز دادند و به­راحتی از ریشه­های معمولی قابل تشخیص بودند. ریشه­های مویین پس از انتقال به محیط MS مایع سریع­تر از نمونه­های کشت شده روی محیط نیمه جامد مشابه رشد کردند (شکل 1).

تأیید تراریختی ریشه­های مویین: الکتروفورز ژل آگارز محصولات PCR در دستگاه ژل داکیومنت مشاهده شد. برای هر یک از نمونه­های ریشه مویین و پلاسمید باکتری (شاهد مثبت) تک باند مشاهده گردید (شکل 2).

بررسی اثر اسید سالیسیلیک بر تولید متابولیت­های ثانویه و وزن خشک ریشه­های مویین: تجزیه واریانس داده­ها نشان داد که غلظت­های مختلف اسید سالیسیلیک بر تولید گلیسیریزین و ایزولیکویریتیجنین در سطح احتمال یک درصد تأثیر معنی­داری داشت. مقایسه میانگین وزن خشک ریشه­های مویین تیمار شده با اسید سالیسیلیک تفاوت معنی­داری را در سطح احتمال یک درصد نشان نداد ولی در سطح احتمال پنج درصد تفاوت معنی­داری مشاهده شد (جدول 1).

اسید سالیسیلیک باعث افزایش معنی­دار در تولید گلیسیریزین شد و بیشترین مقدار گلیسیریزین بر اثر تیمار با 500 میکرو­مولار اسید سالیسیلیک بدست آمد. در غلظت­های پایین­تر اسید سالیسیلیک میزان تولید گلیسیریزین تفاوت معنی­داری با شاهد نداشت. تیمار ریشه­های مویین با اسید سالیسیلیک باعث کاهش معنی­دار ایزولیکویریتیجنین شد. البته کمترین مقدار این ماده در 500 میکرو­مولار بدست آمد.

 

 

جدول1- مقایسه میانگین میزان تولید گلیسیریزین و ایزولیکویریتیجنین به روش  Duncanدر غلظت­های مختلف اسید سالیسیلیک در سطح احتمال 1 درصد و وزن خشک در سطح احتمال 5 درصد

اسید سالیسیلیک (Mμ)           وزن خشک((mg             گلیسیریزین(μg/g)            ایزولیکویریتیجنین(μg/g)

                           0                          ab 6/280                          b 83/27                           a 36/90

125                        a 337                              b 52/10                           b 73/23

250                        a 55/321                          b 95/17                           b 42/25

500                         b 55/154                          a2/97                             b 72/17

آزمون وزن خشک در سطح احتمال 1 درصد معنی دار نشد

 

جدول2- آزمون همبستگی بین وزن خشک، مقدار گلیسیریزین و ایزولیکویریتیجنین بر اثر تیمار با اسید سالیسیلیک

                                                                          گلیسیریزین           ایزولیکویریتیجنین         وزن خشک

                               گلیسیریزین                1

                                      ایزولیکویریتیجنین          267/0-                    1

                                           وزن خشک            ٭٭993/0 -               150/0                         1

 

جدول3- مقایسه میانگین وزن خشک، میزان تولید گلیسیریزین و ایزولیکویریتیجنین به روش Duncan در غلظت­های مختلف متیل جاسمونات در سطح احتمال 1 درصد

متیل جاسمونات(Mμ)           وزن خشک((mg             گلیسیریزین(μg/g)            ایزولیکویریتیجنین(μg/g)

                                     0                                 a6/280                         a 83/27                           a 36/90

                                     50                                a 6/234                        ab 77/16                          b 16/14

100                                a 8/431                        a 05/20                            b 73/8

200                             a       3/323                         b 73/2                             b 22/10

 

اگر­چه کمترین مقدار ایزولیکویریتیجنین در غلظت 500 میکرو­مولار اسید سالیسیلیک حاصل شد ولی در این غلظت رنگ محیط بر خلاف تیمار با سایر غلظت­ها تغییر نمود و بافت ریشه، قهوه­ای و نرم شد که ممکن است در این غلظت فلاونوئیدها از جمله ایزولیکویریتیجنین وارد محیط کشت شده­باشند (شکل3). برای پاسخ دقیق­تر نیاز به بررسی مولکولی همزمان ژن­های مسیر تولید ایزولیکویریتیجنین در این غلظت می­باشد.

 

 

 

شکل2- نتایج ژل محصولات  PCRریشه­های مویین شیرین بیان. چاهک شماره1: مارکر مولکولی (Kb1)، چاهک شماره :7 پلاسمید باکتری، چاهک شماره 9: ریشه طبیعی، چاهک شماره 2: آب مقطر و بقیه چاهک­ها: ریشه های مویین

 

 

کمترین میزان وزن خشک (154 میلی‌­گرم) ریشه­ها در تیمار500 میکرو­مولار اسید سالیسیلیک مشاهده شد. نتایج آزمون همبستگی (جدول 2) نیز رابطه معکوس بین وزن خشک و مقدار گلیسیریزین را در نتیجه تیمار با اسید سالیسیلیک نشان داد. در بررسی آزمون همبستگی بین ایزولیکویریتیجنین و گلیسیریزین رابطه معنی­داری بر اثر تیمار با اسید سالیسیلیک مشاهده نشد که می­تواند نشان‌ دهنده تنظیم متفاوت این ترکیبات در گیاه باشد.

 

شکل3- تغییر رنگ محیط در غلظت 500 میکرومولار اسید سالیسیلیک (سمت چپ)

بررسی اثر متیل جاسمونات بر تولید متابولیت­های ثانویه و وزن خشک ریشه­های مویین: نتایج تجزیه واریانس داده­ها در غلظت­های مختلف متیل جاسمونات و سطح احتمال یک درصد بر تولید گلیسیریزین و ایزولیکویریتیجنین تأثیر معنی­داری داشتند. میانگین وزن خشک ریشه­ها در غلظت­های مختلف متیل جاسمونات تفاوت معنی­داری با نمونه­های شاهد نشان نداد، ولی افزایش وزن در غلظت های 100 و 200 میکرو­مولار مشاهده شد (جدول 3). بیشترین تأثیر برای افزایش وزن خشک با غلظت 100 میکرو­مولار متیل جاسمونات بدست آمد، هرچند این اختلاف معنی­دار نبود. اما نتایج کاهش تولید مواد مؤثره گلیسیریزین و ایزولیکویریتیجنین را با استفاده از متیل جاسمونات نشان داد. در بررسی آزمون همبستگی وزن خشک، تولید گلیسیریزین و ایزولیکویریتیجنین بر اثر تیمار با متیل جاسمونات رابطه معنی­داری مشاهده نشد.

بحث

نتایج وا و همکاران (46) روی ریشه¬های مویین گیاه Evcommia ulmodes نشان داد که غلظت¬های بالای سالیسیلیک باعث تغییر رنگ و مورفولوژی ریشه¬ها و ترشح ترکیبات به محیط می¬شود، که دلیل آن را جلوگیری از اثرات سمی سالیسیلیک بیان کردند. خلیلی و همکاران (26) با به¬کار بردن محرک اسید سالیسیلیک روی ریشه¬های مویین Silybum marianum، کاهش وزن ریشه¬ها و در مقابل افزایش ماده مؤثر سیلیمارین و فلاونولیگنان¬های تاکسیفلینوسیلیبین و کاهش ایزوسیلیبین را گزارش نمودند، که با نتایج تحقیق حاضر مطابقت دارد. همچنین در مطالعات اثر اسید سالیسیلیک روی ریشه¬های مویین Azadira chtaindica، افزایش تولید ترکیبات مؤثره در این ریشه¬ها مشاهده¬گردید (33). در مطالعات مانث و همکاران (30) روی ریشه¬های Vicia faba کاهش قابل توجه رشد ریشه و ایجاد سمیت بر اثر تیمار با غلظت¬های بالای 5/3 میلی¬مولار اسید سالیسیلیک مشخص گردید.

در بیشتر گزارش‌ها تیمار با متیل جاسمونات باعث القاء و افزایش بیوسنتز ترکیبات ثانویه شده است و در گزارش‌های معدودی نیز کاهش تولید متابولیت¬ها را سبب می‌¬شود. شبانی و همکاران (7) با بکار بردن متیل جاسمونات روی گیاهچه¬های شیرین‌¬بیان، افزایش ترکیبات فنولیک و فلاونوئیدی کل در ریشه¬های این گیاه را گزارش کردند. همچنین شبانی و همکاران (38) کاهش وزن خشک ریشه و افزایش تولید گلیسیریزین را در نتیجه تیمار گیاهچههای شیرین‌ بیان با متیل جاسمونات گزارش کردند. در تحقیقات تاگوچی و همکاران (41) استفاده از اسید جاسمونیک در غلظت های 100 - 0 میکرو¬مولار، مقدار متابولیت¬های تروپان آلکالوئیدی را کاهش داد. در گزارش‌های سلیمانی و همکاران (6) ماده مؤثره آرتمیزینین با بکار بردن محرک اسید جاسمونیک روی ریشه¬های مویین Artemisia annua کاهش یافت.

گیاه شیرین­بیان ترکیبات ثانویه مختلفی را تولید می­کند و گلیسیریزین و ایزولیکویریتیجنین تنها دو گروه از این ترکیبات می‌­باشند و در مسیر تولید تریترپنوئید ساپونین گلیسیریزین در این گیاه، ترکیبات ثانویه دیگری مانند انواع استرول­ها و تری‌ترپنوئید­ها تولید می­شوند. در تحقیقات هایاشی و همکاران (22) بکار بردن محرک متیل جاسمونات در کشت سلولی شیرین‌­بیان، میزان سویا ساپونین را افزایش داد، در صورتی‌که حتی با محرک نیز گلسیریزین تولید نشد. افزایش تولید گلیسیریزین در شیرین‌­بیان معمولا با کاهش تولید سایر تریترپنوئید ساپونین­ها (سویا ساپونین یک و دو) و بعکس همراه می­باشد (22). در مورد مسیر فلاونوئیدی شیرین­بیان، چالکون­های مختلفی تولید می­شوند و ایزولیکویریتیجنین یکی از آن­ها و ایزومر ساختمانی ترکیب لیکویریتیجنین است و این دو ترکیب قابل تبدیل به یکدیگر می­باشند (25، 39، و 47). افزایش گلیسیریزین در مقابل کاهش ایزولیکویریتیجنین با بکار بردن اسید سالسیلیک، کاهش ایزولیکویریتیجنین با هر دو محرک، کاهش هر دو متابولیت با متیل جاسمونات و حتی اثرات متفاوت یک محرک در غلظت­های مختلف روی یک ماده مؤثره را می­توان به تفاوت مسیر بیوسنتزی گلیسیریزین و ایزولیکویریتیجنین و مسیر سیگنالی متفاوتی که دو محرک در غلظت­های مختلف منجر به فعال شدن آن­ها می­گردند، نسبت داد. با شناخت کامل ژن­های مسیر بیوسنتزی گلیسیریزین و ایزولیکویریتیجنین که موضوع تحقیقات مولکولی مختلف است و مطالعه اثر محرک­های اسید سالیسیلیک و متیل جاسمونات می­توان پاسخ دقیقی به چگونگی عمل این محرک­ها داد. همچنین اثر متنوع محرک­ها به عوامل مختلفی مانند غلظت محرک، مدت زمان هم‌­کشتی سلول با آن­ها، نوع کشت (کشت سوسپانسیونی، شاخساره یا ریشه)، مرحله رشد سلول و ژنوتیپ گیاه بستگی دارد (48). مرادی و همکاران (10) با بکار بردن اسید سالیسیلیک در کشت گیاهچه و ریشه مویین شابیزک، دلیل تغییرات بیان دو ژن PMT وH6H در مسیر تولید آتروپین و اسکوپولامین را به اثرات متفاوت غلظت­های مختلف اسید سالیسیلیک در بیان ژنهای مذکور در اندام­های مختلف گزارش کردند. در این تحقیق از ریشه‌های مویین 55 روزه به‌ منظور بررسی اثر دو محرک و مدت زمان هم­کشتی 72 ساعت با محرک­ها استفاده شد و تنها ژنوتیپ در دسترس و قابل استفاده از منطقه ورزنه اصفهان بود. در صورتی‌که با تغییر هر یک از این شرایط، ممکن است نتایج متفاوتی بدست آید.

در غلظت 500 میکرو­مولار اسید سالیسیلیک کاهش رشد و افزایش گلیسیریزین و تغییر مورفولوژیکی ریشه­ها (قهوه­ای و نرم شدن بافت ریشه) مشاهده شد. با توجه به اینکه در مطالعات هایاشی و همکاران (20) مقدار گلیسیریزین اندازه­گیری شده در ریشه­های گیاهچه-های دو هفته­ای شیرین­بیان کم بود ولی با افزایش سن گیاه افزایش یافت. در بررسی­های داورپناه و همکاران (5) ریشه­های مسن شیرین‌­بیان دارای بیشترین مقدار گلیسیریزین بودند و زمان مطلوب برداشت ریشه­ها در پایان فصل پاییز (پایان فصل رشد) گزارش شد. می­توان نتیجه گرفت احتمالا تولید گلیسیریزین در مراحل پایانی رشد ریشه، زمانیکه سلول­های ریشه به­سمت پیری می­روند، افزایش می­یابد و استفاده از عواملی که منجر به پیری سلول­ها می­شوند برای افزایش تولید گلیسیریزین می­تواند مفید باشد.

سپاسگزاری

از گروه بیوتکنولوژی دانشکده کشاورزی، دانشگاه بوعلی سینا و و کلیه کسانی که به­نحوی در انجام این تحقیق همکاری نمودند، صمیمانه تشکر و قدردانی به عمل می آید.

1-   اصغری، غ (1385). بیوتکنولوژی گیاهان دارویی و تولید داروهای گیاهی، انتشارات جهاد دانشگاهی اصفهان. 287 صفحه
2-   جایمند، ک و رضایی، م (1381). اندازه­گیری گلیسیریزین در ریشه گیاه شیرین بیان (Glycyrrhiza glabra L.) توسط دستگاه کروماتوگرافی با کارایی بالا (HPLC). فصلنامه گیاهان دارویی، شماره 14. صفحه 13-1
3-   حاجی مهدی پور، ه، امن زاده، ی، حسنلو، ط، شکرچی، م، عابدی، ز و پیر علی همدانی، م (1387) . بررسی کیفیت ریشه­های شیرین بیان جمع آوری شده از رویشگاه­های مختلف ایران. فصلنامه گیاهان دارویی، سال هفتم . دوره سوم.صفحه 114-106
4-   حسنلو، ط، رضازاده، ش و رهنما، ح (1387). ریشه­های مویین منبعی برای تولید ترکیبات با ارزش دارویی. فصلنامه گیاهان دارویی، شماره 29. صفحه 1-17
5-   داورپناه، ز، شیخ زین الدین، م، دخانی، ش و سعیدی، ق (1388). بررسی اثر فصل و منطقه برداشت بر میزان اسید گلیسیریزیک، املاح معدنی و قند موجود در ریشه شیرین بیان. مجله علوم و فنون کشاورزی و منابع طبیعی، شماره 47. صفحه 44-27
6-   سلیمانی، ط،کیهانفر، م، پیری، خ، حسنلو، ط و گودرزی، م (1389). ایجاد ریشه­های مویین در سه گیاه دارویی بومی ایران و مطالعه اثر محرک­های مناسب بر تولید متابولیت­های ثانویه در این ریشه­ها. پایان نامه کارشناسی ارشد بیوتکنولوژی دانشکده کشاورزی، دانشگاه بوعلی سینا
7-   شبانی، ل و احسان پور، ع، ا (1388). القاء آنزیم­های آنتی اکسیدان، ترکیبات فنولیک و فلاونوئید در کشت در شیشه شیرین بیان (Glycyrrhiza glabra L.) با استفاده از متیل جاسمونات و سالیسیلیک اسید. مجله زیست شناسی ایران. جلد 22. شماره 4. صفحه703-691
8-   فارسی، و، ذوالعلی، ج (1382). اصول بیوتکنولوژی گیاهی. انتشارات دانشگاه مشهد.ترجمه. 495 صفحه
9-   قاسمی، ع (1388). گیاهان دارویی و معطر:شناخت و بررسی اثرات آن­ها. انتشارات دانشگاه آزاد اسلامی واحدشهرکرد. 541 صفحه
10- مرادی، ا، شریفی، م و موسوی، الف (1390). بررسی بیان ژن H6H و ایزوفرم­های PMT تحت تاثیر غلظت­های مختلف اسید سالیسیلیک در ریشه مویی و اندام­های مختلف شابیزک( Atropa balladonna L.). مجله زیست شناسی ایران. جلد 24. شماره 3. صفحه 372-366
11- نصیری اصل، م و حسین زاده، ح (1385). مروری بر اثرات ضد ویروسی شیرین بیان(Glycyrrhiza glabra L.) و ترکیب موثره آن گلیسیریزین. فصلنامه گیاهان دارویی. سال ششم. دوره بیست و دوم.12 -1
12- یاری خسرو شاهی، ا (1383). بررسی پاسخ به کشت بافت در سرخدار و میزان تاکسول تولیدی در شرایط In vitro. پایان نامه کارشناسی ارشد بیوتکنولوژی دانشکده کشاورزی،. دانشگاه تبریز
 
13- Cinatl, J., Morgenstern, B., Bauer, G., Chandra, P., Rabenau, H. and Doerr, H. W. (2003).Glycyrrhizin, an active component of liquorice roots, and replication of SARS-associated coronavirus Lancet,  361: 2045-2046
14- Citovsky,V., Kozlivsky. S. V., Lacroix, B., Zaitsman, A., Dafiny Yelin, M., Vyas, S., Tovkach, A. and Tzfira, T. (2007). Biological systems of the host cell involved in Agrobacterium infection. Cellular Microbiology, 9(1): 9-20
15- Dixon, R. A and Gonzales, R. A. (1995). Plant cell culture. A parctical approach .Second edition.Oxfordord university press.
16- Giri, A. and Narasu, L. M. (2000). Transgenic hairy roots: Recent trends and applications. Biotechnology Advances, 18(1): 1-22
17- Guillen, S,. Tremouillaux-Guillen, J., Pati, P K., Rideau, M., and Gantet, P. (2006). Harnessing the potential  of hairy roots. Trends in Biotechnology, 24: 403-409
18- Han, B. , Zheng, Q., Wang, J. ,Chen, W., Tang, H., Wang, Q., Wang, X and Li, J. (2010). Isoliquiritinenin extractied from licorice  Glycyrrhiza uralensis roots by A facile conversion technique.Chemistry of Natural Compounds, 46 pp
19- Hayashi, H. and Sudo, H. (2009). Economic importance of licorice. Plant Biotechnology, 26: 101–104.
20- Hayashi, H., Fukui, H. and Tabata, M. (1993). Distribution pattern of saponins in different organs of Glycyrrhiza glabra. Planta Medica, 59: 351-353
21- Hayashi, H., Hiraoka, N., Ikeshiro, Y., Yamamoto, H. and Yoshikawa, T. (1998). Seasonal variation of glycyrrhizin and isoliquiritigenin in the root of Glycyrrhiza glabra. Biological and Pharmacetical. Bulletin, 21(9): 987-989
22- Hayashi, H., Huang, P., Kenichiro, I. (2003). Up regulation of soyasaponin biosynthesis in cultured cells of Glycyrrhiza glabra. Plant Cell Physiology, 44(4): 404-411
23- Hu, Z. B and Du, M. (2006). Hairy root and its application in plant genetic engineeering. Journal of Integrative Plant Biology, 48(2): 121-127
24- Hurst, W. J., Mckim, J. M. and Martin. R. A. (1983). High-performance liquid chromatographic determination of glycrrhizin in licorice products. Journal of Agriculture. Food Chemistery, 31: 387-389
25- Joung, J., kasthuri, G. M., Park, J., Kang, W., Kim, H., Yoon, B., Joung, H. and Jeon, J. (2003). An overexpression of chalcone reductase of Pueraria Montana var.lobata alters biosynthesis of anthocyanin and 5’-deoxyflavonoids in transgenic tobacco. Biochemical and Biophysical Rezsearch Communicationa, 303: 326-331
26- Khalili, M., Hasanloo, T., Kazemi Tabar, S. K. and Rahnama, H. (2009). Influence of exogenous salicylic acid on flavonolignans and lipoxygenase activity in the hairy root cultures of Silybum marianum. Cell Biology International, 33: 988-994
27- Kokate, C. K. (2006). Medicinal plant biotechnology.CBS publisher and distributors 506 pp
28- Li, W., Asad, Y. and Yoshikawa, T. (2000). Flavonoid constituents from Glycyrrhiza glabra hairy root cultures. Phytochemistry, 55: 447- 456
29- Liu, X. R., Li, L., Wang, Q., Wang, W., Bi, S. K. and Guo, D. A. (2005).Simultaneous determination of nine flavonoids in dalbergia odorifera by LC. Chromatographia, 61: 409–413
30- Manthe, B., Schulz, M. and  Schnabl, H. (1992). Effects of salicylic acid on growth and stomatal movements of Vicia faba L.: evidence for salicylic acid metabolization Journal of Chemistry Ecology, 18: 1525-1539
31- Murashige, T. and Skoog, F. (1962).A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physioligy of Plant,  15: 473-497
32- Namdeo, A. G. (2007). Plant Cell Elicitation for Production of Secondary Metabolites. Pharmacognosy Reviews, 1: 69-79.
33- Prakash, G., Ashok, K., Srivastava, M. (2008). Statistical elicitor optimization studies for the enhancement of azadirachtin production in bioreactor Azadirachta indica cell cultivation. Biochemistery  Engineering Journal, 40: 218-226
34- Radman, R., Saez, T., Bucke, C. and Keshavarz, T. (2003). Elicitation of plant and microbial systems. Biotechnology and Applied Biochemistry, 37: 91-102
35- Ramachandra, S. R.and Ravishankar, G. A. (2002). Plant cell cultures: Chemical factories of secondary metabolites. Biotechnology Advanced, 20: 1001-153
36- Ravishankar, G. A. and Ramachandra, R. S. (2000). Biotechnological production of phyto-pharmaceuticals. Journal of Biochmistry Molecular Biology and Biophysics,  4: 73-102
37- Sambrook, J., Fritrsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Laboratory Press, Cold Spring, Harbor, NY
38- Shabani, L., Ehsanpour, A. A., Asgari, G. and Emami, J. (2009). Glycyrrhizin production by in vitro cultured Glycyrrhiza glabra elicited by methyl Jasmonate and salicylic acid. Russian Journal of Plant Physiology, 56( 5): 621–626
39- Shimada, N., Nakatsuka, T., Nishihara, M., Yamamura, S. A. and Aoki, T. (2006).. Isolation and characterization of a cDNA encoding polyketide reductase in Lotus japonicus. Plant Biotechnology, 23: 509-513
40- Stephanie, G., Jocelyne, T. G., Pratap, K. P. Marc, R. and Pascal. G. (2006). Hairy root research:recent scenario and prospects. Current Opinion in Plant Biology, 9: 341-346
41- Taguchi, G., Sharan, M., Gonda, K., Yanagisawa, K., Shimosaka, M., Hayashida, N. and Okazaki, M. (1998). Effect of methyl jasmonate and elicitor on PAL expression in tobacco cultured cells. Journal of Plant Biochemistry and Biotechnology, 7: 79-84
42- Talarczyk, A. and Hennig, J. (2001). Early defence responses in plants infected with pathogenic organisms. Cell and. Molecular. Biology. Letters, 6: 955–970
43- Tzfira, T. and Citovsky, V. (2006). Agrobacterium-mediated genetic transformation of plant biology and biotechnology. Current Opinion in Biotechnology, 17: 147-154
44- Valko, M., Izakovic. M., Mazur, M., Rhodes, C. J. and Telser, J. (2004). Role of oxygen radicals in DNA damage and cancer incidence. Molecular Cell Biochemistry, (1-2): 37-56
45- Wang, Z. H., Nishioka, M., Kurosaki, y., Nakayama, T. and Kimura, T. (1995). Gastrointestinal absorption characteristics of glycyrrhizin from Glycyrrhiza extract. Biological and Pharmacetical. Bulletin, 18(9): 41-1238
46- Wu, X. (2007). Establishment and chemical analysis of haity root of Eucommia ulmodies.The Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the School of Renewabe Natural Resources
47- Zhang, H. C., Liu, J. M., .Lu, H. Y. and Gao, S. L. (2009). Enhanced flavonoid production in hairy root cultures of Glycyrrhiza uralensis Fisch by combining the over- expression of chalcone isomerase gene with the elicitation treatmen. Plant Cell Reports 28: 1205-1213
48- Zhao, J., Hu, Q., Gu,Y. Q. and  Zhu, W. H. (2001). Elicitor-induced indole alkaloid biosynthesis in Catharanthus roseus cell cultures is related to Ca2+-influx and the oxidative burst. Plant Science, 161: 423
49- Ziemienowicz. A. (2001). Odysseyof Agrobacterium T-DNA. Acta Biochemica Polonica, 48(3): 623-6350
Volume 27, Issue 3 - Serial Number 3
November 2014
Pages 440-449
  • Receive Date: 02 February 2012
  • Revise Date: 14 June 2012
  • Accept Date: 01 July 2012
  • First Publish Date: 22 November 2014