Study on the structure of OeAOX2 gene related to rooting among native olive genotypes (Olea europea L.) of Iran

Document Type : Research Paper

Authors

1 NIGEB, Tehran, Iran

2 CNR

3 NIGEB

Abstract

Olive (Olea europaea L.) is one of the most important fruit crops throughout the Mediterranean Basin, mainly propagated by cuttings. One of the fundamental processes in woody plant propagation, especially olive is rooting ability of cuttings. Rooting ability in various plants and ecotypes is different significantly. Also, many genes are affecting rooting ability process in plants. One of these is OeAOX2 gene which plays a central role in the balance of reactive oxygen species in plants. OeAOX2 as a candidate gene has been introduced and it induces rooting in an Italian olive population (Cross progenies of Leccino and Dolce Agogia). In this project, rooting ability of 99 semi-hard cutting of Iranian olive genotypes was studied from different provinces of Iran, so genotypes with high- and low-rooting ability were determined. Then, the full length of OeAOX2 gene was evaluated in two Iranian olive genotypes such as Dalahoo (high rooting) and Uzineh (low rooting) from Kermanshah and Golestan provinces, respectively. Also, the sequence of this gene was studied in 20 Iranian olive genotypes with high and low rooting in 5’UTR and exon 1 region. Bioinformatics studies of the OeAOX2 gene indicated that there are many polymorphisms in the introns, but only one polymorphism was observed in the exon levels. On the other hand, polymorphism of the OeAOX2 gene in 20 Iranian olive genotypes did not lead to protein alteration and probably it influenced rooting induction in transcript level.

Keywords

مطالعه ساختار ژن OeAOX2 مرتبط با ریشه­زایی در بین ژنوتیپ­های زیتون
(
Olea europea L.) بومی ایران

وحیده هدایتی1، امیر موسوی1*، ثریا موسوی2، زهرا هاشم‌آبادی1 و سید مهدی حسینی مزینانی1

1تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری (NIGEB)

2ایتالیا، پروجا، انستیتو علوم زیستی و منابع طبیعی (IBBR-CNR)

تاریخ دریافت: 30/10/96              تاریخ پذیرش: 15/8/97

چکیده

زیتون (Olea europaea L.) یکی از مهمترین گونه‌های باغی در حوزه مدیترانه است که روش تکثیر آن از طریق قلمه می­باشد. ریشه­زایی قلمه­ها یکی از فرایندهای اساسی در ازدیاد گیاه زیتون است. توانایی ریشه­زایی در قلمه گیاهان و ارقام مختلف بطور معنی­داری با یکدیگر متفاوت است. از طرفی ژن­های متعددی در این فرایند نقش دارند. یکی از این ژن­ها OeAOX2 می­باشد که در تعادل انواع اکسیژن واکنشی نقش اصلی را بر عهده دارد و به‌عنوان ژن کاندید در القای ریشه­زایی در جمعیت زیتون ایتالیایی حاصل از تلاقی ژنوتیپ­های لچینو و دلچه آگوجا معرفی شده است. دراین مطالعه، توانایی ریشه­زایی در قلمه­های 99 ژنوتیپ زیتون ایران از استان­های مختلف بررسی شد و ژنوتیپ­ها با توانایی ریشه­زایی بالا و پایین تعیین شدند. سپس بررسی طول کامل ژن OeAOX2 در دو ژنوتیپ زیتون ایران، دالاهو (ریشه­زایی بالا) و اوزینه (ریشه­زایی پایین) به ترتیب از استان­های کرمانشاه و گلستان، انجام شد. همچنین، توالی این ژن در 20 ژنوتیپ زیتون ایران با ریشه­زایی بالا و پایین در ناحیه 5’ UTR و اگزون شماره 1 نیز بررسی گردید. بررسی­های بیوانفورماتیکی طول کامل ژن OeAOX2 در دالاهو و اوزینه نشان داد که چندشکلی­های زیادی در نواحی اینترون وجود دارد ولی در سطح اگزون­ها تنها یک چندشکلی مشاهده شد. از سوی دیگر، بررسی چند شکلی­های این ژن در 20 ژنوتیپ دیگر زیتون ایران مشخص نمود که این چند شکلی­ها منجر به تغییر اسیدهای آمینه­ها نمی­شود و احتمالاً ژن OeAOX2 در سطح ترانسکریپتوم و تفاوت بیان، القای ریشه­زایی را می‌تواند تحت تأثیر قرار دهد.

واژه­های کلیدی: ژنوتیپ­های زیتون ایران، توان ریشه­زایی، چندشکلی، ژن OeAOX2

* نویسنده مسئول، تلفن: 44787305-021، پست الکترونیکی: [email protected]

مقدمه

 

زیتون (Olea europaea L.) درختی همیشه سبز از تیره Oleaceae و از قدیمی­ترین گیاهان منطقه مدیترانه و ایران است. این گیاه دیپلوئید (2n=46)، هتروزیگوت و تک­پایه است. ازدیاد زیتون به دو روش جنسی و غیرجنسی می­باشد که روش ازدیاد غیرجنسی از طریق قلمه ارزان­تر و سریع­تر از روش­های دیگر می­باشد. شایان ذکر است که با روش ازدیاد غیرجنسی می­توان پایه­های مطلوب و امیدبخش را با حفظ خصوصیات ژنتیکی گیاه‌پایه، در مدت‌زمان کوتاه­تری تکثیر نمود. تولید ریشه از بخش­هایی نظیر ساقه یا قلمه ازنظر مولکولی فرایندی بسیار پیچیده است که بصورت طبیعی در گیاه رخ می­دهد. بنابراین، شناسایی عوامل کنترل­کننده­ی تولید ریشه اعم از عوامل فیزیولوژیکی، مورفولوژیکی و مولکولی گام مهمی در فرایند ازدیاد زیتون محسوب می­شود. شناسایی ژن­های مؤثر در ریشه­زایی قلمه­های زیتون به‌منظور افزایش توان ریشه­زایی ارقام و ژنوتیپ های بومی زیتون ایرانی از اهمیت ویژه­ای برخوردار است. هدایتی و همکاران در سال 2015 برای اولین بار ژن اکسیداز تناوبی 2 زیتون (OeAOX2) را کاندید مناسبی جهت غربالگری زیتون­های با توان ریشه­زایی متفاوت در جمعیت زیتون ایتالیایی معرفی نمودند. این ژن از زنجیره­ی تنفسی در UQ مشتق شده و بدون انتقال پروتون، اکسید شدن UQH2 را کاتالیز کرده و اکسیژن (O2) را به آب احیا می­کند و بیان آن در قلمه­های زیتون با ریشه­زایی بالا در جمعیت زیتون ایتالیایی مورد مطالعه افزایش می­یابد (9). در تحقیق حاضر برای اولین بار، صفات مرتبط با ریشه­زایی در 99 ژنوتیپ زیتون ایرانی ثبت گردید و بر آن اساس ژنوتیپ­های با ریشه زایی بالا (93 تا 100 درصد ریشه­زایی) و ژنوتیپ­های با ریشه­زایی پایین (6 تا 31 درصد ریشه­زایی) مشخص شدند. سپس توالی کامل ژن OeAOX2با طول حدود 4000 جفت بازدر ژنوتیپ­های دالاهو با 94 درصد ریشه­زایی از استان کرمانشاه و اوزینه با 31 درصد ریشه­زایی از استان گلستان همسانه سازی و بررسی شد. از سوی دیگر، منطقه 5’UTR و اگزون 1 در 21 ژنوتیپ دیگر با ریشه­زایی بالا و پایین نیز جهت یافتن چندشکلی مرتبط با القای ریشه­زایی مورد مطالعه قرارگرفت.

مواد و روشها

مواد گیاهی: دراین تحقیق از 99 ژنوتیپ زیتون ایران از استان­های گلستان، کرمانشاه، گیلان، زنجان، خراسان جنوبی، لرستان، خوزستان، کهگیلویه، بوشهر، یزد، ایلام و فارس، موجود در کلکسیون زیتون ایران واقع در استان گلستان، استفاده شد (14و 15). قلمه­گیری از بخش بالای کانوپی و شاخه­های یکساله صورت گرفت. هر قلمه حاوی 4 گره (Node) و 4 برگ رأسی بود. حداقل 20 قلمه از هر ژنوتیپ، تهیه شد و از هورمون IBA (Indole-3- Butyric Acid) با غلظت ppm 2000 به‌منظور ریشه­دار شدن استفاده گردید. قلمه­ها در گلخانه میست با رطوبت بالاتر از 90 درصد و دمای بستر 23 درجه سانتی‌گراد و دمای محیط 18 درجه سانتی‌گراد نگهداری شدند. بعد از دو ماه، صفات ریشه­زایی ازجمله تعداد قلمه­های ریشه­دار شده، درصد ریشه­زایی، طول و تعداد ریشه­ها اندازه­گیری شدند و ژنوتیپ­های زیتون با ریشه­زایی بالا و پایین از یکدیگر تفکیک گردیدند.

همسانه­سازی ژن OeAOX2 در 22 ژنوتیپ زیتون بومی ایران: به‌منظور توالی یابی طول کامل ژن OeAOX2 در ژنوتیپ­های منتخب ایرانی، از نواحی مختلف آن نظیر انتهای '3 و '5 ژن، نواحی داخل اگزون و گاها اینترون، آغازگرهای کاملاً اختصاصی طراحی گردید (جدول 1). از برگ‌های تازه، نمونه­ها DNA استخراج شد و کیفیت DNA با دستگاه اسپکتروفوتومتر نانودراپ C2000  (Thermo Scientific) تأیید گردید، سپس حدود 30-20 نانوگرم از DNA­ها جهت انجام واکنش PCR استفاده شد و با استفاده از آغازگرهای طراحی‌شده از ژن OeAOX2 بهینه­سازی آزمون PCR صورت گرفت. واکنش PCR در حجم µl20 شامل 20 تا 30 نانوگرم از DNA، µl2 از بافر 10X، µl1 از MgCl2 (50mM)، آغازگرها 10 pmol به مقدار µl1 و آنزیم Taq به مقدار µl2/0 و با شرایط C94 به مدت 5 دقیقه، 35 چرخه با C94، 25 ثانیه، C58، 25 ثانیه و C72، 2 دقیقه و تکثیر نهایی C72 به مدت 10 دقیقه انجام شد و محصولات PCR بر روی ژل آگارز 1 درصد مشاهده گردید.

سپس قطعات تکثیر شده وارد ناقل پلاسمیدی pTG19-T (Sinaclone)  شدند. واکنش اتصال شامل، DNA ناقل (25 ng/µl) µl1، بافر اتصال (10X)  µl1، محصول PCR µl5 و آنزیم T4 DNA Ligase µl1 در حجم  µl10، بود و به مدت 1 ساعت در 22 درجه سانتی­گراد و سپس به مدت یک شبانه روز در دمای 16 درجه سانتی­گراد قرارگرفت. محصول آزمایش اتصال وارد سویه­یDH5α E. coli شد و باکتری­ها بر روی محیط LB/Amp/IPTG/X-GAL کشت شدند. جهت تأیید مجدد کلونی­های رشد کرده در محیط کشت، واکنش Colony PCR انجام شد و محصول PCR بر روی ژل آگارز 1 درصد مشاهده گردید. از هر ژنوتیپ دو کلون حاوی قطعه ژن مورد نظر برای توالی­یابی ارسال گردید. به‌منظور توالی­یابی ژن OeAOX2 از آغازگرهای متفاوت و همپوشان، استفاده گردید (جدول 1). از سوی دیگر از آغازگرهای 5’UTR-For و Intron 1-Rev جهت تکثیر اگزون 1 و ناحیه 5’UTR در 21 ژنوتیپ استفاده و محصول PCR مستقیماً توالی یابی شد.

 

جدول 1- فهرست آغازگرهای مورد استفاده جهت همسانه­سازی ژن OeAOX2

نام آغازگر

توالی نوکلئوتیدی آغازگرها (5'->3')

OeAOX2-5´ UTR-For2

GTTTTTCACCGGGCGTAGTA

OeAOX2-exon 1-For

GGCGAGATCTCTGATGAAGC

OeAOX2-intron 1-Rev

TGTGGATCGAGCTCACAGAG

OeAOX2-exon 2-Rer

CTGGAAAAATATATCTGTTGGAATT

OeAOX2-intron 2-For

TCAATTTATGTTGCATATCTTAACCAG

OeAOX2-exon 3-Rev

CTCGATGGTGGGCTTCAT

OeAOX2-3´UTR-Rev

TGTATAACAAAACCGGGACCA

 


بررسی بیوانفورماتیکی ژن OeAOX2 در ژنوتیپ­های زیتون ایرانی:نتایج توالی­یابی­های مرتبط با یک کلونی با استفاده از نرم­افزار BioEdit مورد بررسی قرارگرفت و با ساختن قطعات Contig طول کامل ژن در هر کلونی بدست آمد. سپس توالی­های کامل ژن OeAOX2 از ژنوتیپ­های دالاهو (از استان کرمانشاه) و اوزینه (از استان گلستان)با 4 آلل ثبت شده از این ژن در دو والد زیتون ایتالیایی در بانک اطلاعاتی NCBI، هم‌ردیف و مقایسه شد. از سوی دیگر توالی پروتئینی OeAOX2 در ژنوتیپ­های دالاهو و اوزینه از طریق ExPASy translate tool (http://web.expasy.org/translate/) بدست آمد. سپس این توالی پروتئینی با توالی پروتئینی حاصل از این ژن در ژنوتیپ­های زیتون ایتالیایی مقایسه گردید. از سوی دیگر، ناحیه 5’UTR و اگزون اول ژن OeAOX2در 21 ژنوتیپ زیتون ایرانی شامل 14 ژنوتیپ با ریشه­زایی بالا و 6 ژنوتیپ با ریشه­زایی پایین (جدول 2) تکثیر و توالی­یابی شد و با ژنوتیپ­های دالاهو و اوزینه مقایسه شدند. چندشکلی­های مشاهده‌شده در اگزون شماره 1 ژن با تبدیل به اسیدآمینه و پروتئین نیز بررسی شدند.

نتایج و بحث

نمودار میزان ریشه­زایی برای 99 ژنوتیپ زیتون بومی ایران بر مبنای ثبت صفات ریشه­زایی (9) ترسیم شد (شکل 1). سپس ژنوتیپ­های دالاهو (استان کرمانشاه)، ماوی 2 (استان خوزستان)، مینودشت 2 و قاضانقایه 6 (استان گلستان)، ده سفید 8 (استان کرمانشاه)، ملکشاهی سیاب درویش و چونان 1- چوار (استان ایلام)، طبس (استان یزد) و دراک (استان فارس) بعنوان ژنوتیپ­های با توان ریشه­زایی بالا و ژنوتیپ­های اوزینه، لیوان و آزادشهر 6 (استان گلستان)، سپید دشت (استان لرستان)، دلی بایار 1 (استان کهگیلویه) و وارک (استان فارس) بعنوان ژنوتیپ­های با توان ریشه­زایی پایین انتخاب شدند (جدول 2). ژن اکسیداز تناوبی(AOX) در گیاهان، خانواده­ی چند ژنی هسته­ای کوچکی هستند که در تک لپه­ای­ها فقط AOX1 و در دولپه­ای­ها AOX1 و AOX2 وجود دارد (10 و 19). البته ژن­های ارتولوگ AOX در گونه­های مختلف به صورت متفاوتی به تنش­های زیستی و غیرزیستی پاسخ می­دهند (11، 12، 13 و 17) تاکنون مطالعات بیانی در مورد ژن­های AOX در گیاهان تک­لپه­ای (6، 7، 21 و 23) و دولپه­ای علفی نظیر آرابیدوپسیس (7 و 23)، سویا (6)، یونجه (4)، هویج (3)، ذرت (18)، کاساوا (24) و خیار (20) انجام شده است. درحالی که در درختان گزارشات محدودی در این زمینه وجود دارد (22و 5). برای اولین بار هدایتی و همکاران (2015) ژن OeAOX2 را به‌عنوان ژن کاندید و مؤثر در القای ریشه­زایی زیتون معرفی کردند (8)، این ژن با طول حدود 4000 جفت باز دارای چهار اگزون و سه اینترون می­باشد (شکل 2). همچنین نوگالس و همکاران در سال 2015 به دلیل چندشکلی زیاد در این ژن، آن را بعنوان یک نشانگر مولکولی جهت برنامه­های اصلاحی در هویج معرفی نمودند (16).

 

 

 

 

جدول 2- ژنوتیپ­های زیتون ایران با ریشه­زایی بالا و پایین

شماره

ژنوتیپ­های زیتون ایران

استان

درصد ریشه­زایی(%)

ریشه­زایی بالا/پایین

1

سپید دشت

لرستان

32

ریشه­زایی پایین

2

دلی بایار 1

کهگیلویه

15

ریشه­زایی پایین

3

وارک

فارس

24

ریشه­زایی پایین

4

لیوان

گلستان

29

ریشه­زایی پایین

5

اوزینه 5

گلستان

31

ریشه­زایی پایین

6

آزادشهر 5

گلستان

9

ریشه­زایی پایین

7

نگین

گلستان

6

ریشه­زایی پایین

8

گرگان

گلستان

24

ریشه­زایی پایین

9

ماوی 2

خوزستان

100

ریشه­زایی بالا

10

مینودشت 2

گلستان

100

ریشه­زایی بالا

11

قاضانقایه 6

گلستان

100

ریشه­زایی بالا

12

ده سفید 8

کرمانشاه

93

ریشه­زایی بالا

13

دالاهو

کرمانشاه

94

ریشه­زایی بالا

14

طبس

یزد

97

ریشه­زایی بالا

15

ملکشاهی-سیابدرویش

ایلام

95

ریشه­زایی بالا

16

چونان 1-چوار

ایلام

96

ریشه­زایی بالا

17

دراک

فارس

96

ریشه­زایی بالا

18

قزل

گلستان

100

ریشه­زایی بالا

19

T8

گلستان

98

ریشه­زایی بالا

20

یاقوت

گلستان

93

ریشه­زایی بالا

21

خوشه

گلستان

98

ریشه­زایی بالا

22

پارسه

گلستان

92

ریشه­زایی بالا

23

T23

گلستان

97

ریشه­زایی بالا

 

 

شکل 2- طول کامل ژن OeAOX2(شامل 4 اگزون و 3 اینترون)

 

 

همچنین آنها نشان دادند که ژن OeAOX2 در زیتون­های ایتالیایی لچینو و دلچه آگوجا هتروزیگوت است و تفرق حاصل از تلاقی آلل­های این دو والد، منجر به بروز نتایج با ریشه­دهی متفاوت می­شود. به‌منظور یافتن ارتباط بین ژن مذکور و ریشه­زایی در ژنوتیپ­های زیتون ایران، جداسازی و توالی­یابی طول کامل ژن OeAOX2 از دو ژنوتیپ دالاهو (با توان ریشه­زایی بالا) و اوزینه (با توان ریشه زایی پایین) انجام شد (شکل 3) و از ترکیب آغازگرهای مختلف برای تأیید قطعه مربوط براساس جدول 3 استفاده گردید.

 

4000bp

1500 bp

3000 bp

2000 bp

M     1       2      3      4      5      6      7     8

شکل 3- الکتروفورز محصول PCR انجام شده از مسیرهای 1 و 5 (M1)، 2 و 6 (M2)، 3 و 7 (M3)، 4 و 8 (M4)؛ همچنین مسیرهای 1 تا 4 DNAی اوزینه و مسیرهای 5 تا 8 DNAی دالاهو می­باشد. مسیر M مربوط به نشانگر وزن مولکولی Ladder Mix (Fermentas) است و مسیرهای M1-4 در جدول 3 توصیف شده­اند.

 

جدول 3- مشخصات آغازگرهای مورد استفاده جهت تکثیر ژن OeAOX2

طول محصول تکثیر یافته

دمای اتصال

جفت آغازگرهای اختصاصی (OeAOX2)

نام Master تهیه شده

bp 3808

˚C60

 3´-UTR-Rev و 5´-UTR-For2

M1

bp 2572

˚C60

Exon 3-Rev2 و exon 1-For

M2

bp 2580

˚C60

3´-UTR-Rev و intron 2-For

M3

bp 1605

˚C60

 exon 3-Revو intron 2-For

M4

 

 

بررسی­های بیوانفورماتیکی طول کامل ژن OeAOX2 در ژنوتیپ­های دالاهو و اوزینه مشخص نمود که چهار چندشکلی در اگزون 1 و چهار چندشکلی در اینترون­ها و حذف 3 نوکلئوتید در اینترون دوم اوزینه وجود دارد. مقایسه ژن مذکور در ژنوتیپ­های دالاهو و اوزینه با 4 آلل گزارش شده از آن در ارقام زیتون ایتالیایی (8) در بانک اطلاعاتی NCBI مشخص نمود که چندشکلی­های موجود در ناحیه 5’UTR ژن OeAOX2 در ارقام زیتون ایتالیایی، در ژنوتیپ­های ایرانی وجود ندارد ولی حذف شدگی 58 جفت بازی ناحیه اینترون دوم در هر دو ژنوتیپ ایرانی مشاهده شد در حالی که این حذف­شدگی در همین ناحیه تنها در آلل شماره 2 رقم لچینو وجود داشت. از سوی دیگر به دلیل مشاهده چندشکلی در اگزون 1 ژن OeAOX2 در دالاهو و اوزینه، این ناحیه به همراه 5’UTR در 21 ژنوتیپ دیگر زیتون ایران با ریشه­زایی بالا و پایین نیز بررسی شد. مطالعات نشان داد که سه چندشکلی در ناحیه 5’UTR در موقعیت­های 45، 60 و 112 جفت بازی و 4 چندشکلی در موقعیت­های 183، 216، 318 و377 در اگزون شماره یک وجود دارد ولی تفاوت معنی­داری بین ژنوتیپ­های با توان ریشه­زایی بالا و پایین یافت نشد. در بعضی از ژنوتیپ­های با توان ریشه­زایی بالا و پایین، جفت­بازهای هتروزیگوت هم مشاهده شد (جدول 4) ولی چندشکلی­های موجود در اگزون 1، اسیدآمینه را در سطح پروتئین تغییر نداد و فقط تغییر نوکلئوتید در باز 377 (T بجای A) در ژنوتیپ­های دراک و مینودشت 6، اسیدآمینه والین را جایگزین گلوتامیک اسید نمود. در اکثر ژنوتیپ­ها نوکلئوتید آدنین در موقعیت 377 مشاهده شد، در حالی که در ژنوتیپ­های لیوان با 29 درصد ریشه­زایی، قازانقایه 6، ملکشاهی-سیاب درویش و T18 به ترتیب با 100%، 6/94% و 6/91% ریشه­زایی در این موقعیت نوکلئوتید A یا T قرارداشت.

 

جدول 4- چند شکلی­های مشاهده شده در ناحیه 5’UTR و اگزون شماره 1 در ژن OeAOX2 در 23 ژنوتیپ زیتون ایران

 

Rooting%

5' UTR

Exon 1

Protein

 

 

45 bp

60 bp

112 bp

183 bp

216 bp

318 bp

377 bp

23

34

68

88

سپید دشت

31.4

C

A

A

G

G

G

A

M

R

S

E

دلی بایار 1

14.5

C

A

A

G

G

G

A

M

R

S

E

وارک

23.5

C

A

A

G

G

G

A

M

R

S

E

لیوان

29

T

A/C

A

G

G

G

A/T

M

R

S

E/V

اوزینه 5

31

T

A

A

G

A

G

A

M

R

S

E

آزادشهر 5

8.9

T

A

A

G

G

G

A

M

R

S

E

نگین

6

T

A

A/C

G

G

G

A

M

R

S

E

گرگان

24.2

T

A

A

G

A

G

A

M

R

S

E

ماوی 2

98.8

T

A

A

G

A

G

A

M

R

S

E

مینودشت 2

100

T

C

A

G

G

G

T

M

R

S

V

قازانقایه 6

100

T

A/C

A

G

G

G

T/A

M

R

S

E/V

ده سفید 8

91.3

T

A

A

G

A/G

G

A

M

R

S

E

دالاهو

93.8

T

A

A

G

G

G

A

M

R

S

E

طبس

97.2

T

A

A

G

G

G

A

M

R

S

E

ملکشاهی-سیابدرویش

94.6

T

A/C

A

G

G

G

T/A

M

R

S

E/V

چونان1-چوار

96

T

A

A

G

A/G

G

A

M

R

S

E

دراک

96.3

T

A

A

G

A/G

G

T

M

R

S

V

T7

100

T

A

A/C

A/G

A/G

G

A

M

R

S

E

T8

97.5

T

A

A/C

A/G

A/G

G

A

M

R

S

E

یاقوت

93

T

A

A

G

A

G

A

M

R

S

E

خوشه

97.8

T

A

A

G

A

G

A

M

R

S

E

پارسه

91.6

T

A/C

A

A/G

G

G/T

T/A

M

R

x

E/V

T23

97.2

T

A

A

G

A

G

A

M

R

S

E

 

 

نظر به اینکه بررسی توالی پروتئین OeAOX2 نیز نشان داد که تغییری در سطوح اسیدآمینه­ایی در ژنوتیپ­های دالاهو و اوزینه نیز رخ نداده است، بنابراین استنتاج می­گردد که ژن OeAOX2 در سطح توالی ژنومی و پروتئینی بین 23 ژنوتیپ زیتون ایران با ریشه­زایی بالا و پایین تفاوت معنی­داری ندارد و به احتمال قوی اثرات این ژن بر روی ریشه­زایی در مرحله بیانی یا ترانسکریپتوم، تغییرات پس از رونویسی یا ترجمه می­باشد. شایان ذکر است در مطالعات قبلی نیز تفاوت بیانی این ژن در مراحل مختلف ریشه­زایی بین ارقام زیتون ایتالیایی با ریشه­زایی بالا و پایین مشهود بوده است (8). لذا برای اثبات این فرضیه، بررسی کمی سطوح بیان این ژن در ژنوتیپ­های زیتون ایران با ریشه­زایی بالا و پایین می­تواند راهکار مناسبی جهت اطمینان از نقش اصلی این ژن در فرایند ریشه­زایی محسوب گردد، هرچند تأثیر عوامل محیطی، تنش‌ها و سایر فاکتورهای فیزیکی قلمه را نیز در طی این فرایند همواره باید مدنظر قرارداد (1و 2).

سپاسگزاری

این پروژه با حمایت مالی مرکز مطالعات و همکاری­های بین‌المللی وزارت عتف و پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری انجام شده است. همچنین از حمایت مالی شرکت زیتون گلستان نمونه برای جمع­آوری قلمه­های زیتون و در اختیار گزاردن امکانات گلخانه میست سپاسگزاری می­شود.

1- امینی، ز.، معلمی، ن.، و سعادتی، س.، 1393. مقایسه اثر تنش کم‌آبی بر تغییرات میزان پرولین و فعالیت آنزیم‌های آنتی‌اکسیدان در سه رقم زیتون (Olea europea L.)، مجله پژوهش‌های گیاهی، 27(2)، صفحات 156-167.
2- درودی، ه.، اکبری نیا، م.، جلالی، غ.، و خسروجردی، ا.، 1387. تأثیر قطر قلمه و بستر کاشت برریشه دهی و زنده مانی قلمه سماق (Rhus coriaria L.). زیست‌شناسی ایران، 21(2)، صفحات 270-277.
 
3- Campos, M. D., Cardoso, H. G., Linke, B., Costa, J. H., Melo, D. F., and Justo, L., 2009. Differential expression and co-regulation of carrot AOX genes (Daucus carota L.). Physiology Plant, vol. 137, PP: 578–91.
4- Cavalcantia, J. H. F., Oliveiraa, G. M., Saraivaa, K. D., Torquatoa, J. P. P., Maiab, I. G., Meloa, D. F., and Costaa, J. H., 2013. Identification of duplicated and stress-inducible Aox2b gene co-expressed with Aox1 in species of the Medicago genus reveals a regulation linked to gene rearrangement in leguminous genomes, Journal of Plant Physiology, vol. 170, PP: 1609– 1619.
5- Costa, J. H., Mota, E. F., Cambursano, M. V., Lauxmann, M. A., Oliveira, L. M. N., and Silva, M. G. L., 2010. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genesin Vigna unguiculata. Journal of Plant Physiology, vol. 167, PP: 561–70.
6- Djajanegara, I., Finnegan, P., Mathieu, C., McCabe, T., Whelan, J., and Day, D. A., 2002. Regulation of alternative oxidase gene expression in soybean. Plant Molecular Biology, vol. 50, PP: 735–742.
7- Fu, A., Liu, H., Yu, F., Kambakam, S., Luan, S., and Rodermela, S., 2012. Alternative oxidases (AOX1a and AOX2) can functionally substitute for plastid terminal oxidase in Arabidopsis chloroplasts. Plant Cell, vol. 24, no. 4, PP: 1579-1595.
8- Hedayati, V., Mousavi, A., Razavi, K. H., Cultrera, N., Alagna, F., Mariotti, R., Hosseini Mazinani, S. M., and Baldoni, L., 2015. Polymorphisms in AOX2 gene are associated with rooting ability of olive cuttings. Plant Cell Reports, DOI 10.1007/s00299-015-1774-0.
9- Hedayati, V, Hosseini Mazinani, M., Pandolfi, S., Alagna, F., and Baldoni, L., 2012. Molecular and morphological analyses to explore the genetic bases of rooting ability olive (Olea europaea L.). Proceedings of the 56th Italian Society of Agricultural Genetics Annual Congress Perugia, Italy, 17-20 September 2012, ISBN 978-88-904570-1-2
10- Li, C. R., Liang, D. D., Li, J., Duan, Y. B., Li, H., Yang, Y. C., and Qin, R. Y., 2013. Unravelling mitochondrial retrograde regulation in the abiotic stress induction of rice ALTERNATIVE OXIDASE 1 genes. Plant Cell Environment, vol. 36, PP: 775–788.
11- Maxwell, D. P., Wang, Y., and McIntosh, L., 1999. The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells. Proc Natl Acad Sci USA, vol. 96, PP: 8271–8276.
12- McIntosh, L., Eichler, T., Gray, G., Maxwell, D., Nickels, R., and Wang, Y., 1998. Biochemical and genetic controls exerted by plant mitochondria. Biochim Biophys Acta: Bioenerg, vol. 1365, PP: 278–284.
13- Mizuno, N., Sugie, A., Kobayashi, F., and Takumi, S., 2008. Mitochondrial alternative pathway is associated with development of freezing tolerance in common wheat. Journal of Plant Physiology, vol. 165, PP: 462–467.
14- Mousavi, S., Hosseini-Mazinani, M., Arzani, K., Yadollahi, A., Pandolfi, S., Baldoni, L., and Mariotti, R., 2014. Molecular and morphological characterization of Golestan (Iran) olive ecotypes provides evidence for the presence of promising genotypes. Genetic Resources and Crop Evolution, 61, PP: 775-785.
15- Mousavi, S., Mariotti, R., Bagnoli, F., Costantini, L., Cultrera, N. G., Arzani, K., Pandolfi, S., Vendramin, G. G., Torkzaban, B., Hosseini-Mazinani, M., and Baldoni, L., 2017. The eastern part of the Fertile Crescent concealed an unexpected route of olive (Olea europaea L.) differentiation. Annals of Botany, 119(8), PP: 1305-1318.

16- Nogales, A., Nobre, T., Cardoso, H. G., and Muñoz-Sanhueza, L., et al., 2015. Allelic variation on DcAOX1 gene in carrot (Daucus carotaL.): An interesting simple sequence repeat in a highly variable intron. Plant gene, vol. 5, PP: 49-55.

17- Ohtsu, K., Ito, Y., Saika, H., Nakazono, M., Tsutsumi, N., and Hirai, A., 2002. ABA independent expression of rice alternative oxidase genes under environmental stresses. Plant Biotechnology Journal, vol. 19, PP: 187–190.
18- Olga, V. K., Evgeny, V. K., Elthon, T. E., and Newton, K. J., 2002. Differential expression of alternative oxidase genes in maize mitochondrial mutants. The Plant Cell, Vol. 14, PP: 3271–3284.
19- Polidoros, A. N., Mylona, P. V., and Arnholdt-Schmitt, B., 2009. AOX gene structure, transcript variation and expression in plants. Physiology Plant, vol. 137, PP: 342–353.
20- Qi, X. H., Xu, X. W., Lin, X. J., Zhang, W. J., and Chen, X. H., 2012. Identification of differentially expressed genes in cucumber (Cucumis sativus L.) root under waterlogging stress by digital gene expression profile. Genomics, vol. 99, PP: 160–168.
21- Saika, H., Ohtsu, K., Hamanaka, S., and Nakazono, M., 2002. AOX1c, a novel rice gene for alternative oxidase, comparison with rice AOX1a and AOX1b. Genes and Genetics Systems, vol. 77, PP: 31–38.
22- Santos Macedo, E., Sircar, D., Cardoso, H. G., Peixe, A., Arnholdt-Schmitt, B., 2012. Involvement of alternative oxidase (AOX) in adventitious rooting of Olea europaea L. microshoots is linked to adaptive phenylpropanoid and lignin metabolism. Plant Cell Report, vol. 31, PP: 1581–1590.
23- Umbach, A. L., Fiorani, F., and Siedow, J. N., 2005. Characterization of transformed Arabidopsis with altered alternative oxidase levels and analysis of effects on reactive oxygen species in tissue. Plant Physiology, vol. 139, PP: 1806–1820.
24- Zidenga, T., Leyva-Guerrero, E., Moon, H., Siritunga, D., and Sayre, R., 2012. Extending cassava root shelf life via reduction of reactive oxygen species production. Plant Physiology, vol. 159, PP: 1396–1407.
Volume 33, Issue 2
March 2020
Pages 386-396
  • Receive Date: 20 January 2018
  • Revise Date: 22 March 2018
  • Accept Date: 06 November 2018
  • First Publish Date: 21 June 2020