Induction of genetic variation in Tarom mahalli and Hashemi rice varieties using ethyl methane sulfonate and assessment of induced variation through SSR markers

Document Type : Research Paper

Authors

1 Former MSc Student, Department of Biotechnology and Plant Breeding, Sari University of Agricultural Sciences and Natural Resources

2 Associate Professor, Department of Biotechnology and Plant Breeding, Sari University of Agricultural Sciences and Natural Resources

Abstract

Background and objectives
Mutational breeding is an effective tool for improvement of agronomic traits in crops. The purpose of this study, mutation induction in local rice varieties using chemical mutagen ethyl methane sulfonate (EMS) to improve their agronomic traits and evaluating genetic variation at M2 generation.
Materials and methods
In this study the effect of EMS concentrations (0, 0.17, 0.35 and 0.51 percent) was studied on Tarom Mahalli and Tarom Hashemi local varieties. Superior genotypes were selected in M2 generation based on phenotypic status as well as their important agronomic traits were recorded.
Results
Evaluation of induced genetic variation was done using agronomic traits as well as 12 SSR (Simple Sequence Repeat) markers at phenotypic and molecular levels, respectively. The EMS effectively reduced significantly average of traits like plant height as well as non-filled grains and increased the mean values for 100-grain weight and panicle length. Mutant no. 13 (derived from Tarom mahalli) had superior agronomic characteristics like lower height (147 cm), more tiller number (37), panicle length (29.3 cm) and filled grains (158) in comparison with its control. Also, mutants no. 3 and 10 (derived from Tarom Hashemi) identified as superior lines and their height were 144 and 139 cm, respectively.
Discussion
Results of the study showed successful induction of genetic variation in mutant lines comparing with respective controls.

Keywords

Main Subjects

القاء تنوع ژنتیکی در ارقام برنج طارم محلی و هاشمی با استفاده از اتیل متان سولفوناتو بررسی تنوع ایجاد شده از طریق نشانگرهای SSR

محمد سیه‌چهره، غفار کیانی* و سیدکمال کاظمی‌تبار

ایران، ساری، دانشگاه علوم کشاورزی و منابع طبیعی ساری، گروه اصلاح نباتات و بیوتکنولوژی

تاریخ دریافت: 24/4/97                تاریخ پذیرش: 25/10/97

چکیده

اصلاح موتاسیونی یکی از ابزارهای مؤثر برای بهبود صفات زراعی در گیاهان می‌باشد. هدف از این مطالعه، القاء جهش بااستفاده از موتاژن شیمیایی اتیل متان سولفونات (EMS) در ارقام محلی برنج به‌منظور بهبود صفات زراعی آنها و ارزیابی تنوع ژنتیکی ایجاد شده در نسل M2 بوده است. دراین آزمایش اثر غلظت‌های مختلف EMS (صفر، 17/0 35/0 و 51/0 درصد) بر ارقام طارم محلی و طارم هاشمی مورد بررسی قرارگرفت. ژنوتیپ‌های برتر ازنظر وضعیت فنوتیپی در نسل M2 گزینش و یادداشت­برداری صفات مهم زراعی در آنها صورت گرفت. ارزیابی تنوع القایی ایجاد شده در سطح فنوتیپی با استفاده از صفات زراعی و نیز در سطح مولکولی با استفاده از 12 نشانگر مولکولی SSR صورت گرفت. EMSبه‌خوبی توانست باعث کاهش معنی‌داری در میانگین صفاتی همانند ارتفاع و تعداد دانه پوک و همچنین باعث افزایش وزن 100 دانه و طول خوشه گردد. موتانت شماره 13 (حاصل از طارم محلی) دارای ویژگی‌های ممتاز زراعی نظیر ارتفاع کم (147 سانتی‌متر)، تعداد پنجه بالا (37)، طول خوشه بلندتر (3/29 سانتی‌متر) و تعداد دانه پر بیشتر (158) نسبت شاهد مربوطه بود. همچنین، موتانت های با کدهای 3 و 10 (حاصل از رقم طارم هاشمی) نیز جزء برترین لاین ها بودند و ارتفاع این لاین ها به ترتیب برابر 144 و 139 سانتی‌متر می‌باشد. نتایج داده‌های مولکولی حاکی از ایجاد تنوع ژنتیکی در لاین­های انتخابی موتانت در قیاس با شاهدهای مربوطه بود.

واژه‌های کلیدی: برنج محلی، موتاژن EMS، نشانگر SSR، صفات زراعی، تغییرات ژنتیکی

* نویسنده مسئول، تلفن: 09111588678، پست الکترونیکی: [email protected] , [email protected]

مقدمه

 

تنوع ژنتیکی اساس و پایه کار اصلاح نباتات است (9). یک به‌نژادگر گیاهی در صورتی می‌تواند شانس موفقیت زیادی در برنامه اصلاحی خود داشته باشد که تنوع و شانس انتخاب مواد مناسب برای او موجود باشد. اصلاح به کمـک جهـش در گیاهـان زراعـی ابـزار مؤثری بـرای به‌نژادگران گیاهی مخصوصاً در محصـولاتی کـه تنوع ژنتیکـی محدودی دارند، می‌باشد. به‌طورکلی هـدف از ایجـاد جهـش مصـنوعی، تغییـر یـک یـا چنـد ژن نزدیـک بـه هـم و شکسـتن همبستگی و افزایش کراسینگ‌اور بین ژنهای مطلوب و نامطلوب می‌باشد (11 و 20). راهبرد اصلی در اصلاح موتاسیونی، ایجاد سریع ارقام گیاهی سازگار و با عملکرد بالاتر و کیفیت بهتر می‌باشد (4). اتیل متان سولفونات با جرم مولی 16/124 g/mol یکی از موتاژن‌های شیمیایی است که کاربرد وسیعی در اصلاح نباتات دارد. اتیل متان سولفونات (EMS) به‌عنوان ماده شیمیایی جهش‌زا باعث تبدیل بازهای G و C به بازهای A و T (ترانزیشن) می‌شود که این ممکن است در زمان ترجمه باعث تغییر نوع پروتئین شود (21). روش‌های مختلفی جهت ارزیابی تنوع ژنتیکی درون جوامع گیاهی وجود دارد. ارزیابی صفات فنوتیپی گیاه همواره در برنامه‌های اصلاحی جهت برآورد تنوع و گروه‌بندی ارقام مورداستفاده بوده است، ولی با توجه به اینکه اندازه‌گیری صفات فنوتیپی برای تعداد زیادی نمونه، نیاز به‌صرف وقت و هزینه زیادی دارد و هم‌چنین ارزیابی فنوتیپی به دلیل اثر محیط بر بیان ژن، ممکن است روش قابل‌اعتمادی برای تعیین تفاوت‌های ژنتیکی نباشد. به همین دلیل، برای بررسی تنوع ژنتیکی از نشانگرهای مولکولی به‌طور گسترده استفاده می‌شود (18). امروزه نشانگرهای ریز ماهواره به دلیل سهولت در کاربرد و تفسیر نتایج و همچنین هم بارز بودن، در بررسی تنوع ژنتیکی و تهیه نقشه ژنتیکی به‌طور گسترده به کار می‌رود (14).

در مطالعه‌ای (13) بذور برنج رقم Katy تحت تیمار EMS با غلظت 2/1، 8/0 و 4/0 درصد قرارگرفته بودند بیشترین درصد ناهنجاری در بیوسنتز کلروفیل در گیاهانی با دز 2/1 درصد تیمار شده بودند ایجاد شد و همچنین موتانت برنج Katy Lmm1 مقاومت بیشتری به بلاست و شیت بلایت نشان داد. در مطالعه‌ای دیگر (1) برنج رقم ندا با استفاده از EMS مورد جهش قرارگرفت و 18 لاین موتانت حاصل از آن را با استفاده از آغازگرهای ISSR مورد ارزیابی قرار گرفتند. 7/53 درصد از آغازگرها چندشکلی را در بین ژنوتیپ‌ها نشان دادند. با استفاده از اشعه گاما ارقام محلی برنج ایرانی شامل سنگ طارم، طارم هاشمی و نعمت مورد جهش قرارگرفت. بوته‌ها در نسل M2 بوسیله صفات مورفولوژیکی و نشانگر مولکولیISJ (intron-exon splice junctions) مورد ارزیابی قرار گرفتند (5). برنج مهمترین گیاه زراعی دنیا و غذای بیش از نیمی از مردم جهان است (16).

ارقام طارم محلی و طارم هاشمی به دلیل کیفیت بالایی که دارند در بین کشاورزان منطقه محبوبیت و جایگاه خاصی در کشت و زرع دارند ولی یکی از مهمترین مشکلاتی که می‌شود برای آنها ذکر کرد ارتفاع بلند آنها می‌باشد که باعث ورس و کاهش عملکرد می‌گردد. هدف از این تحقیق القاء تغییرات ژنتیکی با استفاده از موتاژن شیمیایی اتیل متان سولفونات (EMS) در ارقام محلی برنج برای اصلاح صفات زراعی و ارزیابی تنوع ایجاد شده در نسل M2 می‌باشد.

مواد و روشها

این تحقیق طی سال‌های 1392 و 1393 در دانشگاه علوم کشاورزی و منابع طبیعی ساری انجام شد. برای انجام این‌ تحقیق از بذور ارقام طارم محلی و طارم هاشمی که از پژوهشکده ژنتیک دانشگاه کشاورزی و منابع طبیعی ساری تهیه گردید استفاده شد. به‌منظور القاء جهش از تیمارهای 17/0، 35/0 و 51/0 درصد موتاژن شیمیایی اتیل متان سولفونات (EMS) برای هر رقم استفاده شد. ابتدا بذور مربوط به هر رقم به مدت 24 ساعت خیسانده شدند. سپس بذور خیسانده شده به مدت 18 ساعت در محلول‌های 17/0 %، 35/0 % و 51/0 % EMS به‌منظور القاء جهش قرارگرفتند. پس‌ازآن، بذور تیمار شده 3 مرتبه و هر بار به مدت 5 دقیقه در آب مقطر شستشو شدند و بعدازآن نیز مجدداً سه مرتبه و هر نوبت 20 دقیقه در آب مقطر قرار گرفتند تا شستشو گردند و درنهایت به مدت 2 ساعت زیر شیر آب جاری شستشو شدند (7). بذور تیمار شده به همراه شاهد هر رقم در مزرعه مورد کشت قرار گرفتند. با جوانه‌زنی بذور مورد تیمار، نسل اول جهش (M1) تولید گردید. عملیات زراعی لازم از قبیل آبیاری، وجین، مبارزه با آفات و امراض طبق روش‌های معمول انجام گرفت. پس از رسیدگی کامل بوته‌ها نسل اول جهش (M1)، برداشت برای هر دز هر رقم به‌طور کامل ولی به‌صورت تک بوته و جداگانه انجام گرفت. در سال دوم و جهت تولید نسل دوم جهش (M2)، بذور جمع‌آوری شده M1 مربوط به هر رقم به‌طور جداگانه در خزانه کشت شدند. پس از یک ماه و رشد کافی بوته‌ها، ژنوتیپ‌های هر رقم به‌طور جداگانه در زمین اصلی به همراه شاهدشان کشت گردیدند. کلیه عملیات زراعی لازم همانند سال اول انجام شد. پس از خروج کامل خوشه‌ها و قبل از رسیدگی کامل آنها، ژنوتیپ‌های M2. مربوط به هر رقم که در مقایسه با شاهدشان دارای ارتفاع کمتر و زودرسی بودند، مورد انتخاب قرارگرفتند. پس از انتخاب اولیه ژنوتیپ‌های M2، ارتفاع (cm)، تعداد پنجه و طول خوشه (cm) آنها به همراه شاهد هر رقم در مزرعه اندازه‌گیری شد. پس از رسیدگی کامل بوته‌ها و برداشت خوشه‌های ژنوتیپ‌های انتخاب‌شده، صفات زراعی دیگر همانند تعداد کل دانه، تعداد دانه پر، تعداد دانه پوک، طول دانه (mm)، عرض دانه (mm) و وزن 100 دانه (gr) در آزمایشگاه مورد اندازه‌گیری قرار گرفت که برای این منظور از هر بوته انتخاب شده سه خوشه نماینده شدند.

به‌منظور ارزیابی تنوع ژنتیکی ایجاد شده، از ژنوتیپ‌های M2 انتخاب شده نمونه برگی گرفته شد. نمونه‌های برگی با استفاده از ازت مایع پودر شده و با استفاده از روش CTAB استخراج DNA صورت گرفت (17). کمیت و کیفیت DNA استخراج‌شده با استفاده از ژل آگارز 8/0 درصد و دستگاه اسپکتروفتومتر Eppendorf biophotometer مورد سنجش قرارگرفت. واکنش زنجیره‌ای PCR در حجم 5/12 میکرولیتر بااستفاده از دستگاه ترموسایکلر TECHNE TC-512 انجام شد. در این تحقیق از 12 پرایمر نشانگرهای SSR (جدول 1) برای ارزیابی تنوع ژنتیکی ایجاد شده استفاده شده است (2).

 

جدول 1- آغازگرهای SSR مورد استفاده جهت ارزیابی تنوع ژنتیکی موتانت های برنج

دمای اتصال

Annealing Temperature

Reverse

Forward

شماره کروموزوم

No. Chromosome

پرایمر

Primer

54

GCGTTGGTTGGACCTGAC

GCGAAAACACAATGCAAAAA

1

RM1

65

CACCTCATCCTCGTAACGCC

CCATTCGTGAGAAGATCTGA

2

RM207

55

CCTCCCATCATTTCGTTGTT

TTCGCCATGAAGTCTCTCG

3

RM7

67

CGCCGGATGTGTGGGACTAGCG

CATCCCCCTGCTGCTGCTGCTG

4

RM119

55

ATGTGATTGTATCAGGCTCG

GTTTCCTGCATGCTTGGAAC

5

RM516

55

TTCGGGGTTGCCGGTGATGTTG

ACCGTCGCCTTCCACTTTCCCC

6

RM121

56.5

ATAGCGGGCGAGGCTTAG

TCTCCTCTTCCCCCGATC

7

RM11

60

CCGTAGACCTTCTTGAAGTAG

GAAACCACCACACCTCACCG

8

RM152

55.5

TGAGCACCTCCTTCTCTGTAG

CAAAATGGAGCAGCAAGAGC

9

RM215

56

ACGAGATACGTACGCCTTTG

AACGCGAGGACACGTACTTAC

10

RM171

55

TCTGCAACGGCTGATAGATG

ACACCAGAGAGAGAGAGAGAGAG

11

RM441

55

CTCTCCCTTCCCAATTCCTC

ACATGATGCGTAGCGAGTTG

12

RM491

 

 

برای انجام PCR، از 5/1 میکرولیتر DNA 50 نانوگرم بر میکرولیتر، 25/1 میکرولیتر بافر PCR با غلظت 10 برابر (10X)، 25/1 میکرومولار MgCl2، 3/0 میکرومولار dNTPs، 35/0 میکرولیتر از آغازگرهای رو به جلو و 35/0 میکرولیتر از آغازگرهای رو به عقب (10 پیکومول)، 2/0 میکرولیتر آنزیم تک پلیمراز (یک واحد آنزیمی) استفاده شد. چرخه دمایی PCR جهت تکثیر DNA با نشانگرهای SSR شامل 4 دقیقه دمای 94 درجه سانتی‌گراد برای واسرشت‌سازی اولیه DNA، 35 چرخه در 94 درجه سانتی‌گراد به مدت 1 دقیقه، 54-67 درجه سانتی‌گراد به مدت 50 ثانیه، 72 درجه سانتی‌گراد به مدت 1 دقیقه و سرانجام 72 درجه سانتی‌گراد به‌عنوان بسط نهایی به مدت 7 دقیقه بوده است. پس از انجام PCR از ژل آگارز 2 درصد برای تفکیک باندهای تولید شده استفاده شد. پس از انجام الکتروفورز، از اتیدیوم برماید برای رنگ‌آمیزی استفاده شد. نهایتاً برای مشاهده الگوی باندی با استفاده از دستگاه ژل‌داک Slite200W عکس‌برداری صورت گرفت. امتیازدهی براساس وجود (1) و عدم وجود باند (0) انجام گرفت. دراین پژوهش مقایسات موتانت ها با شاهد از طریق t-student  و مقایسات میانگین از طریق LSD نسبت به شاهد انجام گردید. به‌منظور تجزیه‌وتحلیل داده‌ها مورفولوژیکی و مولکولی به ترتیب از نرم‌افزارهای SPSS و NTSYS استفاده شد.

 

نتایج

تجزیه‌وتحلیل داده‌های مورفولوژیکی: ارتفاع زیاد ارقام طارم محلی و طارم هاشمی و عملکرد نسبتاً پایین، از مهمترین صفات نامطلوب آنها می‌باشد. مقایسات میانگین نشان داد که استفاده از EMS تأثیر بسزایی در کاهش ارتفاع ژنوتیپ‌های M2 رقم طارم محلی نسبت به شاهد آن داشته است (جدول 2). در بررسی حاضر، EMS باعث افزایش معنی‌دار وزن 100 دانه رقم طارم محلی در دز 51/0 درصد شده است ولی در دیگر دزها اثر معنی‌داری نداشته است. با اعمال EMS، صفات تعداد دانه پوک و تعداد پنجه در هیچ سطحی و در هیچ دزی نسبت شاهدشان معنی‌دار نشده است (جدول 2). طول خوشه در دز 51/0 درصد نسبت به شاهد دارای افزایش بسیار معنی‌داری بود.

چون انتخاب بر مبنای ارتفاع کمتر نسبت به شاهد بوده است، همانند طارم محلی کاهش ارتفاع در ژنوتیپ‌های حاصل از طارم هاشمی در هر سه دز بسیار معنی‌دار گردیده است. اعمال EMS نتوانسته باعث افزایش و یا کاهش معنی‌دار میانگین وزن 100 دانه در ژنوتیپ‌های طارم هاشمی شود. کاهش تعداد دانه پوک در تمامی دزهای ژنوتیپ‌های رقم طارم هاشمی معنی‌دار گردیده است. اعمال EMS باعث کاهش میانگین طول خوشه در ژنوتیپ‌های رقم طارم هاشمی شده به طوریکه این کاهش در دز 35/0 درصد معنی‌دار شده است. همانند طول خوشه، تعداد پنجه نیز کاهش پیدا کرده است و این کاهش در دز 51/0 درصد معنی‌دار بوده است.

اثر EMS بر روی صفت طول خوشه در ژنوتیپ‌های دو رقم متفاوت بوده است که ممکن است به دلیل ماهیت تصادفی بودن جهش‌ها و یا به دلیل ساختار ژنتیکی دو رقم باشد.

صفات زراعی ژنوتیپ‌های‌ انتخابی ارقام طارم محلی و طارم هاشمی در نسل M2 به همراه شاهد در جداول 3 و 4 نشان داده شده است. در بین ژنوتیپ‌های M2 مربوط به طارم محلی، کمترین ارتفاع و بیشترین طول خوشه متعلق به ژنوتیپ شماره 14 می‌باشد. ژنوتیپ‌های شماره 4، 5، 12 و 13 نسبت به شاهد طارم محلی دارای پنجه بسیار بیشتری می‌باشند. ژنوتیپ شماره 13 در رقم طارم محلی بیشترین تعداد کل دانه و همچنین بیشترین تعداد دانه پر نسبت به دیگر ژنوتیپ‌ها و شاهد را دارا می‌باشد. ژنوتیپ شماره 8 در رقم طارم محلی با داشتن وزن 100 دانه‌ای معادل 83/2 گرم بیشترین وزن دانه را در بین دیگر ژنوتیپ‌ها داشت.

در بین ژنوتیپ‌های M2 مربوط به طارم هاشمی، ژنوتیپ شماره 5 دارای کمترین ارتفاع می‌باشد. در رقم طارم هاشمی تنها ژنوتیپ 8 نسبت به شاهد دارای پنجه بیشتری می‌باشد. ژنوتیپ شماره 2 در طارم هاشمی دارای طول خوشه بلندتری بود. ژنوتیپ شماره 4 در طارم هاشمی، هم دارای تعداد کل دانه بیشتری نسبت به دیگر ژنوتیپ‌ها و شاهد است و هم دارای بیشترین تعداد دانه پر می‌باشد. ژنوتیپ شماره 16 با داشتن وزن 100 دانه‌ای معادل 3 گرم بیشترین وزن دانه را در بین دیگر ژنوتیپ‌ها داشت.

تجزیه‌وتحلیل داده‌های مولکولی: شکل‌های 1 و 2 نتایج گروه‌بندی ژنوتیپ‌های M2ارقام طارم محلی و طارم هاشمی را با استفاده از داده‌های مولکولی SSR نشان ‌می‌دهند. در هریک از این اشکال ژنوتیپ شماره 1 شاهد هر رقم می‌باشد. موتانت های حاصل از رقم طارم محلی در دو گروه اصلی متمایز شده‌اند بطوریکه موتانت‌های با کدهای 3، 5، 13 و 14 در یک خوشه به همراه شاهد مربوطه قرارگرفته‌اند که حاکی از شباهت ژنتیکی بیشتر آنها با والد مربوطه می‌باشد. از بین این لاین‌ها، موتانت شماره 13 دارای ویژگی‌های ممتاز زراعی نظیر ارتفاع کم (147 سانتی‌متر)، تعداد پنجه بالا (37)، طول خوشه بلندتر (3/29 سانتی‌متر) و تعداد دانه پر بیشتر (158) نسبت شاهد مربوطه می‌باشد (جدول 3). موتانت‌های حاصل از رقم طارم هاشمی در دو گروه اصلی و هرکدام به ترتیب با سه و دو زیرگروه از همدیگر متمایز شدند، بطوریکه موتانت‌های با کدهای 3و 10 در یک خوشه به همراه شاهد مربوطه قرارگرفته‌اند که حاکی از شباهت ژنتیکی بیشتر آنها با والد مربوطه می‌باشد. ارتفاع این لاین­ها به ترتیب برابر 144 و 139 سانتی‌متر می‌باشد.

 

شکل 1- گروه‌بندی حاصل از تجزیه خوشه‌ای لاین های موتانت حاصل از رقم طارم محلی به همراه شاهد (کد 1) با استفاده از داده‌های حاصل از نشانگرهای SSR

 

 

شکل 2- گروه‌بندی حاصل از تجزیه خوشه‌ای لاین های موتانت حاصل از رقم طارم هاشمی به همراه شاهد (کد 1) با استفاده از داده‌های حاصل از نشانگرهای SSR

 

 

جدول 2- مقایسه میانگین صفات در نسل M2 با استفاده از آزمون LSD نسبت به شاهد

طارم هاشمی

Tarom hashemi

طارم محلی

Tarom mahalli

صفات

شاهد

control

0.17%

0.35%

0.51%

شاهد

control

0.17%

0.35%

0.51%

 

152.4

146.33**

137.5**

140.5**

161.33

147.4**

146**

148.25*

ارتفاع

Height

1.41

1.71

5.64

3.22

1.49

1.70

1.25

5.68

ضریب تغییرات

CV

2.54

2.41ns

2.48ns

2.69ns

2.34

2.43ns

2.3ns

2.57*

وزن 100 دانه

100-grain weight

0.73

10.49

6.45

7.54

1.26

4.09

16.6

1.23

ضریب تغییرات

CV

12.2

3.6**

4.3**

6.8*

9.8

13.6ns

28ns

5.25ns

تعداد دانه پوک

No. non-filled grains

10.91

41.65

48.5

51.82

32.39

77.22

97.72

9.52

ضریب تغییرات

CV

28.6

26.96ns

25.85*

27.38ns

25.92

26.42ns

27.2ns

29.3**

طول خوشه

Panicle length

2.06

7.97

8.23

4.31

0.5

4.19

2.7

1.21

ضریب تغییرات

CV

31.6

22ns

23.75ns

19.37**

27.4

27.4ns

18ns

25.25ns

تعداد پنجه

Tiller number

5.1

27.64

33.92

34.22

3.7

50.34

31.75

56.22

ضریب تغییرات

CV

 

جدول 3- صفات اندازه‌گیری شده‌ موتانت­های انتخابی در نسل M2 در رقم طارم محلی

ژنوتیپ

Genotype

ارتفاع

height (cm)

پنجه

tiller

طول خوشه

Panicle length (cm)

تعداد  کل دانه

Total grain

تعداد دانه پوک

No. of unfilled grain/panicle

تعداد دانه پر

No. of filled grain/panicle

قطر دانه

Grain width (mm)

طول دانه

Grain length (mm)

وزن 100 دانه

100-grain weight (gr)

Control (1)

161

27

25.9

137

9

128

1.91

10.1

2.34

2

143

20

27.6

120

25

95

1.95

10.54

2.54

3

149

13

26.1

112

4

108

1.98

10.59

2.4

4

148

39

24.8

162

25

147

1.87

9.91

2.3

5

149

45

27.3

133

8

125

1.79

10.15

2.52

6

148

20

26.3

139

6

133

1.84

9.57

2.39

7

144

25

27.5

132

40

92

1.8

9.3

2.09

8

147

12

28.1

138

5

133

1.97

10.13

2.83

9

145

15

26.6

158

61

97

1.9

9.34

2.33

10

148

20

26.6

133

6

127

1.77

8.45

1.96

11

160

21

29

135

5

130

1.8

9.1

2.53

12

146

36

29.1

130

6

124

1.83

9.92

2.6

13

147

37

29.3

163

5

158

1.91

9.95

2.54

14

140

7

29.8

122

5

117

1.99

9.8

2.57

 

جدول 4- صفات اندازه‌گیری شده‌ موتانت­های انتخابی در نسل M2 در قم طارم هاشمی 

ژنوتیپ

Genotype

ارتفاع

height (cm)

پنجه

tiller

طول خوشه

Panicle

length

(cm)

تعداد  کل دانه

Total grain

تعداد دانه پوک

No. of

unfilled

grain/panicle

تعداد دانه پر

No. of filled

grain/panicle

قطر دانه

Grain width (mm)

طول دانه

Grain

length (mm)

وزن 100 دانه

100-grain

weight

(gr)

Control  

152.4

31

28.6

124

12

112

1.98

10.3

2.54

2

146

15

29.1

101

4

97

1.88

10.75

2.7

3

144

26

27

94

2

92

1.95

9.93

2.22

4

149

25

24.8

168

5

163

2.01

9.46

2.32

5

128

21

27.5

95

2

93

2

10.21

2.6

6

141

23

26

105

4

101

1.84

9.57

2.48

7

135

16

22.8

115

4

111

2.05

9.84

2.6

8

146

35

27.1

100

7

93

2.04

10.49

2.26

9

146

18

28.5

139

14

125

1.88

9.28

2.45

10

139

27

25

91

5

84

1.87

9.35

2.8

11

148

22

28

120

10

110

1.81

10.33

2.45

12

138

13

27.6

116

4

112

1.92

10.23

2.86

13

138

22

26.8

118

6

112

1.93

9.68

2.55

14

134

16

27.1

127

3

124

2.06

9.85

2.75

15

140

9

28.8

117

7

110

1.99

10.05

2.66

16

141

28

27.3

120

6

114

1.92

10.16

3.02

 

 

بحث و نتیجه‌گیری

تغییرات مورفولوژیکی مانند کاهش ارتفاع و افزایش وزن 100 دانه، کاهش تعداد دانه پوک و افزایش طول خوشه در اصلاح برنج اهمیت بسیار زیادی دارند. انتخاب اولیه و اصلی دراین پژوهش بر مبنای زودرسی و ارتفاع کمتر بوده است. خوابیدگی ساقه یکی از مشکلات مهم در محصول برنج است که معمولاً باعث کاهش کمی و کیفی عملکرد شده و برداشت محصول را نیز با مشکل مواجه می‌کند (12). خوابیدگی ساقه در برنج معمولاً در نتیجه انحراف ساقه از حالت عمودی و حتی قرارگرفتن افقی آن روی زمین، علاوه برکندی در عملیات برداشت، می‌تواند عملکرد را تا 80 درصد کاهش دهد (19). همانطور که در جدول 2 آمده است کاهش ارتفاع ژنوتیپ‌های M2 هر رقم در تمامی دزها بسیار معنی‌دار شده است. تغییرات مهمی چون کاهش ارتفاع و مقاومت به خوابیدگی اثر مستقیمی برافزایش کودپذیری گیاه دارد و افزایش کودپذیری موجب افزایش عملکرد نیز می‌شود. تغییر هریک از این صفات می‌تواند به تنهایی منجر به افزایش یا کاهش عملکرد که هدف نهایی این‌گونه بررسی‌ها است بشود. طبق مطالعاتی که (3) با استفاده از موتاژن شیمیایی EMS روی برنج رقم طارم محلی انجام دادند، گزارش کردند که ارتفاع بوته‌های جهش‌یافته نسبت به شاهد کمتر بوده است (8). رقم باسماتی 370 را تحت تاثیر دزهای مختلف اشعه گاما قراردادند که آنها نیز کاهش ارتفاع بوته را در مطالعات خود گزارش کرده‌اند.

در مطالعه‌ی (6) که از اشعه گاما برای ایجاد جهش استفاده گردید، هم افزایش وزن 100 دانه و هم کاهش آن را گزارش گردیده است. با استفاده از EMS (3) و با استفاده از گاما (10) ارقام برنج را مورد جهش قراردادند. آنها نیز افزایش تعداد دانه پوک را نسبت به شاهد گزارش کردند. افزایش تعداد دانه پوک در تحقیق (3) بسیار کمتر از تحقیق (10) بوده است. این امر می‌تواند به دلیل استفاده از ارقام مختلف و نوع موتاژن باشد. در گزارش‌هایی که (23) ارائه کردند هم افزایش و هم کاهش طول خوشه مشاهده شده است درحالیکه (13) تفاوت معنی‌داری در طول خوشه مشاهده نکردند.

در مطالعه حاضر جهش باعث کاهش تعداد پنجه شده است. این نتیجه با نتایج (18) مطابقت دارد ولی با نتایج (10) که از اشعه گاما برای اعمال جهش استفاده کردند، مغایرت دارد. آنها افزایش تعداد پنجه را در مطالعه‌ی خود مشاهده کردند (15). با استفاده از EMS رقم Nagina22 را اعمال جهش کردند. آنها هم افزایش و هم کاهش تعداد پنجه را مشاهده کردند.

در بین موتانت‌های مورد مطالعه حاصل از طارم محلی، موتانت شماره 13 دارای ویژگی‌های ممتاز زراعی نظیر ارتفاع کم (147 سانتی‌متر)، تعداد پنجه بالا (37)، طول خوشه بلندتر (3/29 سانتی‌متر) و تعداد دانه پر بیشتر (158) نسبت شاهد مربوطه می‌باشد (جدول 3). از بین موتانت های حاصل از رقم طارم هاشمی، موتانت­های با کدهای 3 و 10 برترین لاین‌ها بودند و ارتفاع این لاین‌ها به ترتیب برابر 144 و 139 سانتی‌متر می‌باشد. سایر مطالعات اصلاحی روی این لاین‌های انتخابی در نسل‌های بالاتر در جریان می‌باشد. باتوجه به اینکه EMS باعث ایجاد جهش‌های نقطه‌ای می‌شود و تجزیه کلاستر داده‌های مولکولی نشان داد که ژنوتیپ‌های با صفات مطلوب موردنظر (ارتفاع، زودرسی، طول خوشه و...) دارای شباهت ژنتیکی زیادی با شاهد هر رقم می‌باشند، از این‌رو انتخاب این لاین‌ها همراه با ادامه ارزیابی‌ها می‌تواند نویدبخش اصلاح و تولید لاین­های معطر جدید و مقاوم به خوابیدگی در آینده نزدیک در ایران می‌باشند. همچنین نتایج حاصل از این تحقیق، کارایی EMS را در اصلاح موتاسیونی ارقام محلی برنج به‌خوبی نشان می‌دهد.

سپاسگزاری

از دانشگاه علوم کشاورزی و منابع طبیعی ساری به خاطر فراهم آوردن امکانات تحقیق سپاسگزاری می‌شود.

1- احمدی خواه، ا.، شجاعیان، ه.، پهلوانی، م. ه.، و نیری پسند، ل.، 1393. شناسایی لاین های موتانت متحمل به شوری در برنج و انگشت‌نگاری آنها با نشانگر  ISSR، ژنتیک نوین، شماره 9 (3)، صفحات 299-312.
2- اله‌قلی‌پور، م.، فرشادفر، ع.، و ربیعی، ب.، 1392. ارزیابی تنوع مولکولی ژنوتیپ‌های برنج (Oryza sativa L.) با استفاده از نشانگرهای ریزماهواره همبسته با خصوصیات زراعی و فیزیکوشیمیایی دانه، مجله علوم زراعی ایران، شماره 15(4)، صفحات 337-354.
3- مجیدی، ز.، بابائیان جلودار، غ. ع.، رنجبر، ن. ع.، و باقری، ن. ع.، 1392. مطالعه تنوع ایجاد شده به‌وسیله اتیل متان سولفونات و سدیم آزید روی رقم برنج طارم محلی، پژوهشنامه اصلاح گیاهان زراعی 5 (12)، صفحات 49-62.
 
4- Ahloowalia, B. S., Maluszynski, M., and Nichterlein, K., 2004. Global impact of mutation-derived varieties. Euphytica, 135, PP: 187-204.
5- Babaei, A., Nematzadeh, G. H., and Hashemi, H., 2011. An evaluation of genetic differentiation in rice mutants using semi-random markers and morphological characteristics. Australian Journal of Crop Science, 5(13), PP: 1715-1722.
6- Baloch, A. W., Soomro, A. M., Mustafa, G., Bughio, M. S., and Bughio, H. R., 1999. Mutagenesis for reduced plant height and high grain yield in Jajai77, an aromatic rice (Oryza sativa L.) variety. Pakistan Journal of Botany, 31 (2), PP: 469-474.
7- Bradley, J. T., Cooper, J., Tai, T. H., Colowit, P., Greene, E. A., and Comai, L., 2007. Discovery of chemically induced mutations in rice by TILLING. BioMedCentral (BMC Plant Biology), 7, 19 p.
8- Bughio, H. R., Asad, M. A., Odhano, I. A., Bughio, M. S., Khan, M. A, and Mastoi, N. N., 2007. Improvement of grain yield in rice variety Basmati-370 (Oryza sativa L.), through mutagenesis. Pakistan Journal of Botany, 39 (7), PP: 2463-2466.
9- De, R. N., Reddy, J. N., Suriava, A. V., and Mohanty, K. K., 1992. Genetic divergence in early rice under two situations. Indian J. Genet, 52, PP: 225-229.
10- Haris, A., and Jusoff, K., 2013. Gamma ray radiation mutant rice on local aged dwarf. Middle-East Journal of Scientific Research, 15(8), PP: 1160-1164.
11- Hase, Y., Akita, Y., Kitamura, S., Narumi, I., and Tanaka, A., 2012. Development of an efficient mutagenesis technique using ion beams: Toward more controlled mutation breeding. Plant Biotechnology, 29, PP: 193-200.
12- Ibrahim, S., and Degwy, E. I., 2013. Mutation induced genetic variability in rice (Oryza sativa L.). International Journal of Agriculture and Crop Science, 5(23), PP: 2789-2794.
13- Jia, Y., Xie, J., and Rutger, J. N., 2006. Development and characterization of Katy deletion mutant populations for functional genomics of host-parasite interactions and rice improvement. Plant Mutation Report, 1(1), PP: 43-47.
14- Mackill, D. J., 2007. Molecular markers and marker-assisted selection in rice. Springer, 2, PP: 147-168.
15- Mohapatra, T., Robin, S., Sarla, N., Sheshashayee, M., Singh, A. K., and Sharma, R. P., 2014. EMS Induced Mutants of Upland Rice Variety Nagina22: Generation and Characterization. Proceedings of the Indian National Science Academy, 80, PP: 163-172.
16- Montalvan, R., and Ando, A., 1998. Effect of gamma-radiation and sodium azide on quantitative character in rice. Genetic and Molecular Biology, 21(1), PP: 244-251.
17- Murray, M. G., and Thompson, W. F., 1980. Rapid isolation of high molecular weight plant, Nucleic Acids Research, 8, PP: 4321-4325.
18- Ronald, L., and Indra, K., 2001. NA-Based Markers in Plants. Springer, 6 p.
19- Setter, T. L., Laureles, E. V., and Mazaredo, A. M., 1997. Lodging reduces yield of rice by self-shading and reduction in canopy photosynthesis. Field Crops Research, 49, PP: 95-106.
20- Shu, Q. Y., and Lagoda, P. J. L., 2007. Mutation techniques for gene discovery and crop improvement. Molecular Plant Breeding, 2, PP: 193-195.
21 - Wattoo, K., Aslam, S., Shab, G, and Shabir, M., 2012. Ethyl methane sulphonate (EMS) induced mutagenic attempts to create genetic variability in Basmati rice. Journal of Plant Breeding and Crop Science, 4(7), PP: 101-105.
Volume 33, Issue 3
September 2020
Pages 579-592
  • Receive Date: 15 July 2018
  • Revise Date: 27 October 2018
  • Accept Date: 15 January 2019
  • First Publish Date: 22 September 2020