نوع مقاله : مقاله پژوهشی

نویسندگان

گروه زیست شناسی، دانشکده علوم پایه، دانشگاه مازندران، بابلسر، ایران

چکیده

نیتروژن به دو فرم آمونیوم و نیترات جذب گیاه شده و دارای اهمیت بالایی در رشد، متابولیسم و فرایندهای حیاتی گیاهان می باشد. به منظور بررسی ارتباط این دو منبع نیتروژنی با متابولیسم سولفور، گیاهان کلزا (Brassica napus) و بروکلی (Brassica oleracea) در محیط هیدروپونیک تحت تیمار متفاوت نیترات و آمونیوم به مدت 14 روز کشت شدند. نتایج نشان داد وزن تر و خشک اندام هوایی در هر دو گیاهچه و همچنین نسبت وزن اندام هوایی به ریشه در گیاهچه کلزای رشد یافته در محیط حاوی نیترات آمونیوم افزایش معنی داری نسبت به پارامترهای رشد گیاه تحت تیمار نیترات داشت. محتوای سولفور کل در اندام هوایی گیاهچه بروکلی تغذیه شده با نیترات آمونیوم نسبت به نیترات بیشتر شد. درحالیکه میزان سولفات در گیاهچه کلزای تغذیه شده با نیترات آمونیوم نسبت به گیاهچه تغذیه شده با نیترات کاهش معنی داری پیدا کرد که با افزایش بیان ژن ناقل سولفات 4:2 همراه بود. علاوه بر این، بیان ژن آدنوزین '5-فسفو سولفات ردوکتاز و به دنبال آن سنتز تیولها و سیستئین در هر دو گیاهچه تحت تیمار نیترات آمونیوم افزایش معنی داری نسبت به پارامترهای ذکر شده در گیاه رشد یافته با نیترات داشت. بنابراین تغذیه نیتروژنی در نسبت مساوی از نیترات و آمونیوم اهمیت بالایی در رشد و سنتز ترکیبات آلی سولفوردار در هر دو گیاهچه دارد. اگرچه اثر مثبت نیترات آمونیوم بر رشد و متابولیسم سولفور در کلزا با نیازمندی بالاتر به جذب سولفور و سنتز ترکیبات آلی سولفوردار، بیشتر از بروکلی بود.

کلیدواژه‌ها

عنوان مقاله [English]

Effect of nitrate and ammonium nitrate on growth, sulfur metabolism and gene expression of sulfate transporters, adenosine triphosphate sulfurylase and adenosine 5'-Phosphosulfate reductase in canola (Brassica napus L.) and broccoli (Brassica oleraceae L.)

نویسندگان [English]

  • Tahereh A. Aghajanzadeh
  • Anahita Hafez alkotob

Department of Biology, Faculty of basic science, University of Mazandaran, Babolsar, Iran

چکیده [English]

Nitrogen is taken up by plants in two forms - ammonium and nitrate and plays an important role in growth, metabolism and vital processes of plants. To investigate the relationship between these two nitrogen sources with sulfur metabolism, the rapeseed (Brassica napus) and broccoli (Brassica oleracea) plants were cultured in a hydroponic medium under nitrate and ammonium treatments for 14 days. The results showed fresh and dry weight of the shoot in both seedlings and also shoot to root ratio in canola seedlings exposed to ammonium nitrate were significantly increased compared to those of the plants grown in nitrate medium. The content of total sulfur in the shoot of the broccoli seedlings exposed to ammonium nitrate was higher than that of plant grown in nitrate medium. While the amount of sulfate in canola seedlings fed with ammonium nitrate was significantly decreased compared to nitrate-fed seedlings which it was accompanied by an increase in the gene expression of sulfate transporter 4:2. In addition, the expression of adenosine 5-phosphosulfate reductase and subsequently the synthesis of thiols and cysteine was increased in both seedlings exposed to ammonium nitrate compared to seedlings grown with nitrate. Therefore, nitrogen fertilizers in an equal proportion of ammonium and nitrate are of great importance in growth and synthesis of organic sulfur compounds in both seedlings. Although the positive effect of ammonium nitrate on growth and sulfur metabolism of canola with higher need for sulfur uptake and synthesis of organic sulfur compounds, was greater than those of broccoli plant.

کلیدواژه‌ها [English]

  • Ammonium nitrate
  • Brassica
  • Gene expression
  • Nitrate
  • Sulfur metabolism

تاثیر تغذیه نیتراتی و نیترات آمونیومی بر رشد، متابولیسم سولفور و بیان ژن ناقلین سولفور، آنزیمهای آدنوزین تری فسفات سولفوریلاز و آدنوزین '5-فسفوسولفات ردوکتاز در گیاهچه های کلزا (.LBrassica napus) و بروکلی (L.Brassica oleraceae)

طاهره السادات آقاجانزاده* و آناهیتا حافظ الکتب

ایران، بابلسر، دانشگاه مازندران، دانشکده علوم پایه، گروه زیست شناسی

تاریخ دریافت: 08/04/1397          تاریخ پذیرش: 04/06/1398

چکیده

نیتروژن به دو فرم آمونیوم و نیترات جذب گیاه شده و دارای اهمیت بالایی در رشد، متابولیسم و فرایندهای حیاتی گیاهان می باشد. بمنظور بررسی ارتباط این دو منبع نیتروژنی با متابولیسم سولفور، گیاهان کلزا (Brassica napus) و بروکلی
(Brassica oleracea) در محیط هیدروپونیک تحت تیمار متفاوت نیترات و آمونیوم به مدت 14 روز کشت شدند. نتایج نشان داد وزن تر و خشک اندام هوایی در هر دو گیاهچه و همچنین نسبت وزن اندام هوایی به ریشه در گیاهچه کلزای رشد یافته در محیط حاوی نیترات آمونیوم افزایش معنی داری نسبت به پارامترهای رشد گیاه تحت تیمار نیترات داشت. محتوای سولفور کل در اندام هوایی گیاهچه بروکلی تغذیه شده با نیترات آمونیوم نسبت به نیترات بیشتر شد. درحالیکه میزان سولفات در گیاهچه کلزای تغذیه شده با نیترات آمونیوم نسبت به گیاهچه تغذیه شده با نیترات کاهش معنی داری پیدا کرد که با افزایش بیان ژن ناقل سولفات 4:2 همراه بود. علاوه بر این، بیان ژن آدنوزین '5-فسفو سولفات ردوکتاز و بدنبال آن سنتز تیولها و سیستئین در هر دو گیاهچه تحت تیمار نیترات آمونیوم افزایش معنی داری نسبت به پارامترهای ذکر شده در گیاه رشد یافته با نیترات داشت. بنابراین تغذیه نیتروژنی در نسبت مساوی از نیترات و آمونیوم اهمیت بالایی در رشد و سنتز ترکیبات آلی سولفوردار در هر دو گیاهچه دارد. اگرچه اثر مثبت نیترات آمونیوم بر رشد و متابولیسم سولفور در کلزا با نیازمندی بالاتر به جذب سولفور و سنتز ترکیبات آلی سولفوردار، بیشتر از بروکلی بود.

واژه های کلیدی: بیان ژن، کلم، متابولیسم سولفور، نیترات، نیترات آمونیوم

* نویسنده مسئول، تلفن: 09113130705،  پست الکترونیکی: t.aghajanzadeh@umz.ac.ir

مقدمه

 

نیتروژن به عنوان یک عنصر ضروری و پرمصرف‌، در انجام اغلب فرایندهای حیاتی گیاه دخالت دارد (2). این عنصر به مقدار 5/1 تا 5/3 درصد از وزن خشک بیشتر گیاهان را تشکیل می دهد (5). نیتروژن در ساختار ترکیبات اولیه و ثانویه گیاهی مانند اسیدهای آمینه، اسیدهای نوکلئیک، بازهای پورینی، آلکالوئیدها و کلروفیل مشارکت دارد (22). مصرف بسیار بالای نیتروژن باعث رشد بیش از حد اندام هوایی و نسبت بالای اندام هوایی به ریشه در بسیاری از گیاهان می گردد (30). علاوه بر این کمبود نیتروژن باعث کاهش بازده فتوسنتز، وزن خشک گیاه، شاخص سطح برگ، میزان پروتئینها، تأخیر در رشد رویشی، زایشی مانند تاخیر در ظهور گل و همچنین کاهش تعداد دانه و تخمک و نیز سبب ریزش برگ ها میگردد (22،3، 26، 50). علاوه بر غلظت نیتروژن، نوع منبع نیتروژنی نیز می تواند از عوامل تاثیر گذار بر عملکرد فرایندهای حیاتی گیاهی باشد. گیاهان نیتروژن معدنی را به دو فرم آمونیوم و نیترات جذب می کنند که البته یون نیترات منبع غالب نیتروژن برای گیاهان میباشد (23، 32). مطالعات اثر متفاوت این دو منبع نیتروژنی بر پارامترهای فیزیولوژیکی، بیوشیمیایی، رشد و عملکرد گیاهان مختلف را نشان داده است. جذب بالای آمونیوم توسط ریشه با آزاد شدن پروتون و اسیدی شدن محیط رشد ریشه همراه است که عامل مهمی در کاهش رشد گیاهان حساس به کاهش اسیدیته (pH) و همچنین اختلال در جذب عناصر غذایی محسوب می گردد (18). در مطالعه ای دیگر نشان داده شده است که رشد گیاه چغندرقند تغذیه شده با آمونیوم کاهش یافته، غلظت قندهای محلول و نامحلول در گیاه تغذیه شده با آمونیوم بطور معنی داری کمتر از گیاه تغذیه شده با نیترات بوده اما محتوای پروتئین و کلروفیل در چغندرقند رشد یافته در حضور آمونیوم بیشتر بوده است (6). افزایش غلظت نیتروژن آمونیومی و بدنبال آن اسیدی شدن محیط ریشه، عموما جذب بالاتری از یونهای کاتیونی را نسبت به آنیونی همراه دارد (27، 34) و برعکس نیترات می تواند تأثیر مثبتی در جذب کاتیونها داشته باشد (12). بهمین ترتیب تغذیه نیتروژن آمونیومی باعث کاهش جذب کلسیم درگیاه بنت القنسول شده که کاهش جذب آب را در گیاه به دنبال داشته است (7، 13). البته برخی از گیاهان مانند گیاهان تیره اریکاسه و تعدادی از مخروطیان که به محیطهایی با pH پایین سازش یافته اند آمونیوم را به عنوان منبع نیتروژنی ترجیح می دهند (11، 19). تاثیر نوع تغذیه نیتروژنی بر مورفولوژی گیاه نیز دیده شده است. بطوریکه تغذیه آمونیومی منجر به تولید شاخه هایی به رنگ سبز تیره، شکننده و میان گره های طویل شد (5).  همچنین چغندر قند تغذیه شده با آمونیوم بافت گزیلمی توسعه یافته تری به دلیل فعالیت بیشتر آنزیم پراکسیداز نسبت به گیاه تغذیه شده با نیترات نشان داد (6).

علاوه بر نیتروژن، سولفور نیز از جمله عناصری می باشد که نقش مهمی در تولید ترکیبات اولیه و ثانویه گیاهی دارد. این عنصر در ساختار اسیدهای آمینه سیستئین، متیونین و در نتیجه در ساختار پروتئین‌ها شرکت می‌کند. همچنین سولفور در تشکیل ویتامینها، گلوکوزیدها و فعال کردن آنزیمها شرکت دارد. علاوه بر این سولفور جزئی از ساختمان فسفو لیپیدها است، در نتیجه در ساخته شدن چربی به طور مستقیم شرکت میکند (31). سولفور به صورت سولفات از طریق هم انتقالی ﭘروتون/ سولفات و صرف مولکول ﭘر انرژی ATP توسط سلولهای ریشه جذب می شود. ناقلین سولفات که درگیر جذب و انتقال سولفات می باشند در 4 گروه متفاوت و هر کدام در چند زیر گروه بر اساس عملکرد و مکان استقرار تقسیم بندی شده اند. گروه 1 که مسئول جذب سولفات از خاک به ریشه گیاه می باشند و بطور عمده در ریشه بیان می شوند. گروه 2 در آوندها مستقر شده و عامل انتقال سولفات در مسیرهای طولانی می باشند. گروه 3 که استقرار آنها بر روی غشای پلاستها گزارش شده است و باعث انتقال سولفات به پلاستها می شوند. گروه 4 که در غشای ارگانل واکوئل مستقر هستند و سولفات را از واکوئل خارج می کند (15، 25، 28، 39). سولفات پس از جذب و قبل از احیا توسط آنزیم آدنوزین تری فسفات سولفوریلاز به فرم فعال آدنوزین-5-فسفو سولفات تبدیل می شود. سپس توسط آنزیم آدنوزین '5-فسفو سولفات ردوکتاز به سولفیت احیا گردیده که به نوبه خود به سولفید از طریق آنزیم سولفیت ردوکتاز احیا می شود. در آخرین مرحله او-استیل سرین تیول لیاز سولفید را به اسید آمینه سیستئین تبدیل می کند که پیش ساز سنتز ترکیبات سولفور دار آلی می باشد (39).

جذب و احیای سولفات و نیترات در ارتباط نزدیک با یکدیگر می باشد. بطوریکه کاهش و یا فقدان یک عنصر باعث ممانعت از روند احیای عنصر دیگر می گردد. فعالیت آنزیمهای درگیر در احیای سولفات و همچنین سطح mRNA این آنزیمها در شرایط کمبود نیتروژن کاهش می یابد (14، 37، 45، 46). از طرفی دیگر کاهش سولفور باعث کاهش جذب نیترات و فعالیت آنزیم نیترات ردوکتاز می شود (42، 44، 45). ارتباط مسیر احیای نیتروژن و سولفور در سنتز سیستئین به عنوان نخستین محصول آلی سولفوردار و همچنین تبدیل سیستئین به ترکیبات سولفوردار مهم دیگر مانند متیونین و گلوتاتیون به خوبی شناخته شده است (37، 40). ترکیبی با نام او-استیل سرین (O-acetylserine) نقطه ارتباطی بین مسیر احیای نیتروژن و سولفور محسوب می شود. این ترکیب به عنوان عامل دهنده اسکلت کربنی و نیتروژن به همراه سولفید حاصل از احیای گوگرد، اسید آمینه سیستئین را به وجود می آورد. او-استیل سرین نیز به نوبه خود از اسید آمینه سرین که حاصل احیای نیتروژن می باشد به همراه استیل کوآنزیم آ ساخته می شود (38).

گونه های جنس کلم دارای توانایی بالایی در جذب و احیای سولفور و همچنین سنتز و تجمع ترکیبات آلی اولیه و ثانویه سولفوردار جهت رشد و حفظ بقا در مقابل عوامل تنش زای محیطی می باشند (9). با توجه به اهمیت تغذیه نیتروژنی و ارتباط آن با جذب و احیای سولفور(14، 36، 44، 47)، در تحقیق حاضر نقش تغذیه نیتروژنی نیترات و نیترات آمونیوم بر محتوای ترکیبات آلی و معدنی سولفوردار و بیان ژنهای کلیدی درگیر در جذب و احیای سولفور در دو گونه کلم، کلزا (Brassica napus Var Hyola 401) و بروکلی (Brassica oleracea Var. capitata) مورد بررسی قرار گرفت.

مواد و روشها

شرایطکشت، رشد و جمع آوریگیاه: بذرهای کلزا (Brassica napus Var Hyola 401) و بروکلی (Brassica oleracea Var. capitata) بترتیب از جهاد کشاورزی بابل و شرکت پاکان بذر اصفهان تهیه گردید. بذرها دو روز پس از خیساندن جوانه زده، سپس دانه رستهای جوان ده روزه به محیط کشت 25 درصد هوگلند شامل 25/1 میلی مولار نیترات کلسیم، 25/1 میلی مولار نیترات پتاسیم،  25/0 میلی مولار پتاسیم دی هیدروژن فسفات، 5/0 میلی مولار سولفات منیزیم، 6/11 میکرومولار اسید بوریک، 4/2 میکرو مولار کلرید منگنز، 24/0 میکرو مولار سولفات روی، 08/0 میکرو مولار سولفات مس، 13/0 میکرو مولار مولیبدات سدیم و 5/22 میکرومولار کلات آهن با بنیان Fe- EDTA  منتقل شدند. گیاهان در محیط کشت هوگلند با غلظت برابر نیتروژن کل ولی در دو تیمار متفاوت تیمار نیتراتی و تیمار نیترات آمونیومی و هر تیمار در سه تکرار به مدت 14 روز رشد یافتند. در تیمار نیترات آمونیوم به جای نیترات پتاسیم و نیترات کلسیم از نیترات آمونیوم، کلرید پتاسیم و کلرید کلسیم استفاده شده است.

دانه رستها در اتاقک کشت در دمای روزانه و شبانه بترتیب 22 و 18 درجه سانتیگراد (1±)، رطوبت نسبی 60 تا 70 درصد، طول دوره نوری و تاریکی به ترتیب 14 و 10 ساعت رشد داده شدند. تعویض محلول غذایی پس از 7 روز صورت گرفت و تنظیم pH  در محدوده 6 هردو روز یک بار انجام گرفت. سپس گیاه بیست و چهار روزه جمع آوری شد. پس از شستشوی ریشه ها با آب مقطر، ریشه ها از اندام هوایی جدا شده و بلافاصله وزن تر ریشه و اندام هوایی اندازه گیری گردید. از نمونه های گیاهی تازه به منظور اندازه گیری تیولهای غیر پروتئینی محلول در آب و سیستئین استفاده شده است. برای تعیین محتوای ماده خشک گیاهی، سنجش آنیونها (سولفات و نیترات)، سولفور و نیتروژن کل، نمونه های گیاهی در آون در دمای 80 درجه سانتی گراد به مدت 24 ساعت خشک گردیدند. برای سنجش میزان RNA نمونه های گیاهی بلافاصله پس از جمع آوری در ازت مایع فریز شده و در فریزر در دمای منفی 80 درجه سانتیگراد نگهداری شدند.

سنجش نیتروژن کل: سنجش نیتروژن گیاه به روش کجلدال انجام گردید (35). پس از اضافه کردن اسید سولفوریک غلیظ و اسید سالیسیلیک به 500 میلی گرم نمونه خشک و پودر شده گیاهی، نمونه ها از 80-70 درجه تا 280 الی 300 درجه سانتی گراد حرارت داده شده و به محض مشاهده بخارات سفید با افزودن 5 قطره آب اکسیژنه عمل هضم انجام شد. در نهایت با استفاده از محلول استاندارد سولفات آمونیوم میزان نیتروژن در نمونه گیاهی بر حسب میکرومول بر گرم وزن خشک بیان گردید (35، 43).

سنجش سولفور کل: مقدار سولفور با استفاده از روش جونز تعیین شد (33). به 200 میلی گرم نمونه گیاهی خشک و پودر شده، قطره قطره محلول نیترات منیزیم50 درصد تا حد اشباع اضافه شد. سپس نمونه گیاهی به آون با دمای 100 درجه سانتی گراد و به مدت 12 ساعت منتقل گردیده و متعاقبا در داخل کوره با دمای 650 درجه سانتی گراد قرار داده تا زمانی که نمونه گیاهی بطور کامل سفید و تبدیل به خاکستر گردد. خاکستر گیاهی در 10 میلی لیتر محلول شامل50 میلی لیتر اسید نیتریک در لیتر آب مقطر و 150 میلی لیتر اسیدکلریدریک در لیتر آب مقطر، حل شده و سپس با آب مقطر به حجم 100 میلی لیتر رسانده شد. به 25 میلی لیتر از عصاره حاصل 2 میلی گرم کلرید باریم اضافه گردیده، بخوبی حل شده و سپس میزان جذب با دستگاه اسپکتروفتومتر در طول موج 450 نانومتر تعیین گردید. میزان سولفور کل با استفاده از محلول استاندارد سولفات پتاسیم  بر حسب میکرو مول بر گرم وزن خشک بیان گردید.

سنجش نیترات و سولفات: برای سنجش نیترات و سولفات، 10 میلی گرم نمونه گیاهی خشک و پودر شده به مدت 4 ساعت در یک میلی لیتر آب مقطر در دمای 50 سانتی گراد در حمام آب قرار داده شد. سپس بمدت 15 دقیقه با دور 30000  gسانترفیوژ گردید (48). اندازه گیری نیترات و سولفات با استفاده از HPLC (با ستون تبادل یونی با ویژگی (IonoSpher 5 A anion exchange column, 250 x 4.6 mm) انجام شد. همچنین فاز متحرک شامل فسفات پتاسیم) 25 میلی مولار) بهمراه 02/0 درصد وزنی حجمی نیترات سدیم با pH در حدود 3/4 بوده است. مقدار سولفور آلی نیز با کم کردن مقدار سولفات از سولفور کل بدست آمد.

سنجش تیولهای غیر پروتئینی محلول در آب و سیستئین: جهت استخراج، مطابق با وزن نمونه به ازای هر گرم نمونه تازه گیاهی، 10 میلی لیتر بافر استخراج شامل اسید سولفوسالیسیلیک (80 میلی مولار)، نمک دی سدیم  اتیلن دی آمین تترا استیک اسید(1میلی مولار) و اسید اسکوربیک (15/0 درصد وزنی حجمی) استفاده گردیده و پس از هموژن شدن کامل با همزن برقی، عصاره حاصل با استفاده از کاغذ صافی صاف شد. (تمام مراحل استخراج در سرما انجام شد).  سپس با دور g 30000 به مدت 15 دقیقه سانتریفیوژ گردید (41).

جهت سنجش تیولهای غیر پروتئینی یک میلی لیتر از محلول روئی عصاره سانتریوفیوژ شده با 1/0 میلی لیتر آب مقطر مخلوط شده و به مدت 5 دقیقه در دمای 20 درجه سانتی گراد قرار داده شد. سپس تیول های کل محلول در اب به روش اسپکتروفتومتری در طول موج 415 نانومتر در حضور 1/0 میلی لیتر دی تیو بیس-2- نیترو بنزوئیک اسید  (10میلی مولار) و 2 میلی لیتر تریس- اسید کلریدریک (02/0 مولار) اندازه گیری شده و بر حسب میکرومول بر گرم وزن تر بیان گردید.

جهت تعیین محتوای سیستئین، تمامی مراحل سنجش تیولهای غیر پروتئینی به استثنای 1/0 میلی لیتر آب مقطر که با 1/0 میلی لیتر متیل گلی اگسال جایگزین شده است، انجام شد. سپس با تفریق این عدد به دست آمده از عدد مربوط به جذب مقدار تیولهای غیر پروتئینی، محتوای سیستئین به دست آمد (21).

استخراج RNA: استخراج RNA کل با استفاده از روش فنل داغ انجام شد (49). نمونه های گیاهی (1 گرم) که بوسیله ازت مایع در هاون چینی ساییده شده بودند بوسیله محلولی (1 میلی لیتر) شامل فنل داغ (80 درجه سانتی گراد) و بافر استخراج که به نسبت 1 به 1 تهیه شده بود، جهت استخراج RNA   مورد استفاده قرار گرفت. بافر استخراج شامل تریس- اسید کلریدریک (1/0 مولار)، لیتیوم کلرید (1/0 مولار)، سدیم دودسیل سولفات (1 درصد وزنی- حجمی)، اتیلن دی آمین تترا استیک اسید (10 میلی مولار) با pH در حد 8 بوده است. بعد از مخلوط کردن با 5/0 میلی لیتر کلروفرم و ایزو آمیل الکل (نسبت 24 به 1) به مدت 10 دقیقه در دمای 4 درجه سانتی گراد، در دورg  13400 سانترفیوژ شدند. سپس فاز آبی به تیوپ دیگری منتقل شد. بعد از اضافه کردن حجم مساوی از کلروفرم و ایزو آمیلو الکل، RNA کل توسط کلرید لیتیوم در دمای 4 درجه سانتی گراد در طی یک شب رسوب کرد. سپس RNA کل با اتانل 70 درصد شستشو داده شد.  بمنظور حذف آلودگی DNA ژنومی، نمونه های استخراج شده با آنزیم   DNase I تیمار شدند. سپس بعد از چند بار شستشو با فنل-کلروفرم–ایزوآمیل الکل و کلروفرم- ایزو آمیل الکل و نهایتا با اتانل، رسوب RNA در آب تیمار شده با دی اتیل پیروکربنات حل گردید. کمیت وکیفیت و یکسان سازی غلظت RNA بوسیله نانودراپ و الکتروفورز مورد بررسی قرار گرفت.

سنتز cDNA و qRT-PCR : برای سنتز cDNA، یک میکروگرم RNA با یک میکرولیتر از هر یک از ترکیبات پرایمر oligo-dT،dNTP ، آنزیم ترانس کریپتاز معکوس (Reverse transcriptase) ، 4 میکرولیتر5x reaction buffer ، 2 میکرولیتر MgCl2، 5/0 میکرولیتر  آنزیم مهارکننده   (Ribo lock RNase inhibitor)  و 5/6 میکرولیتر آب در یک میکروتیوب مخلوط شده و با آب مقطر به حجم 20 میکرولیتر رسانده و سپس بترتیب در دمای 25 درجه سانتی گراد به مدت 5 دقیقه، 42 درجه سانتی گراد به مدت یک ساعت و نهایتا 70 درجه سانتی گراد به مدت 15 دقیقه قرار داده شد. در تیوپ های 25 میکرولیتری 2 میکرولیتر cDNA سنتز شده به عنوان الگو، 75/0 میکرولیتر  پرایمر ، 5/12 میکرولیتر SYBR Green master mix  تهیه شده از شرکت  Thermo Scientific با 75/9 میکرولیتر آب مخلوط گردید. برنامه مورد استفاده برای Real-time PCR عبارت بود از یک دمای دناتوراسیون 94 درجه اولیه به مدت 10 دقیقه، 35 چرخه دمایی شامل دناتوراسیون در 95 درجه به مدت 45 ثانیه، اتصال در 60 درجه به مدت 30 ثانیه، طویل شدن رشته الگو در دمای 72 درجه به مدت30 ثانیه و در نهایت گسترش نهایی واکنش در دمای 72 درجه به مدت 5 دقیقه که با استفاده از سیستم Applied Bio Systems’ 7300 جهت تعیین سطح رونویسی ژنها انجام شد. سطح رونویسی ژنها بر اساس بیان ژن اکتین 2 به عنوان ژن رفرنس نرمال سازی و با استفاده از روش دلتا Ct محاسبه شد. به این ترتیب که در واقع بیان نسبی ژنها بر اساس روش دلتا Ct از طریق تفریق Ct ژن هدف از Ct ژن رفرنس (ژن اکتین 2) بدست آمد (51).

برای طراحی پرایمر، از توالیهای کدکننده ژنهای ناقلین سولفات 4:1،1:2،1:1، 4:2، آنزیمهای آدﻧﻮزﻳﻦ تری فسفات سولفوریلاز، آدﻧﻮزﻳﻦ ﻓﺴﻔﻮ ﺳﻮﻟﻔﺎت ردوکتاز و اکتین در آرابیدوپسیس تالیانا برای ردیابی هومولوگهای ژنهای مربوطه در گیاهان کلزا  و بروکلی که از طریق پایگاه داده های موجود در NCBI بدست آمد، استفاده شد. توالی های این ژن ها با شماره پذیرش که در زیر آمده است، یافت می شود. ناقل سولفات 1:1(NM116931.3, ES902683.1, ES905969.1, ES905955.1, (EX072147.1, DK480431.1, NM116931.3، ناقل سولفات 1:2(NM001334809.1, ES905969.1, EX072147.1, DK480431.1, ES902683.1, EV114249.1)، ناقل سولفات 4:1 (NM121358.3, DK485280.1, DK487793.1, ES910927.1, ES908067.1)، ناقل سولفات 4:2 (NM112087.3, DK481240.1, DK473273.1, DK467793.1)، آنزیم آدﻧﻮزﻳﻦ تری فسفات سولفوریلاز (AF198964.1, DK500807.1, DK500923.1, DK499761.1, ES903732.1)،  آدﻧﻮزﻳﻦ ﻓﺴﻔﻮ ﺳﻮﻟﻔﺎت ردوکتاز (AF023167.1, NM_116699.3, EV203385.1, ES901933.1) و اکتین 2 (NM001338358.1, EV114680.1, EV113171.1, DK507714.1, DY018249.1, DK467047.1)).  دمای ذوب پرایمرهای ژنهای مورد مطالعه و همچنین اکتین، 60 درجه سانتی گراد بود. پرایمرهای مستقیم و معکوس ژنها در جدول 1 مرتب گردید.

 

جدول 1- توالی پرایمرهای مورد استفاده جهت تعیین سطح رونویسی ژنهای ناقلین سولفات 1:1، 1:2، 4:1، 4:1، آنزیمهای آدﻧﻮزﻳﻦ تری فسفات سولفوریلاز و آدﻧﻮزﻳﻦ ﻓﺴﻔﻮ ﺳﻮﻟﻔﺎت ردوکتاز.

ژن

Gene

توالی پرایمرها('3-'5)

مستقیم

معکوس

ناقل سولفور1:1  (Sultr 1;1)

CTCAGGATATTGGATACGCTAAG

TGCACCACCCATGAATCC

ناقل سولفور1:2  (Sultr 1;2)

CTCGGTCTCCAGTCTGTC

TGCACCACCCATGAATCC

ناقل سولفور4:1  (Sultr 4;1)

CTTGCGATTGGACCTGTT

GGCCGAAGCACTTGTAAAT

ناقل سولفور4:2  (Sultr 4;1)

GATTCCACCTCTTCTGATGATG

TGCCAGCCATGAGATCAA

آدﻧﻮزﻳﻦ تری فسفات سولفوریلاز

ATCGACGTGCAGTGGATG

GCCAGTTTCCAGCGTTAG

آدﻧﻮزﻳﻦ ﻓﺴﻔﻮ ﺳﻮﻟﻔﺎت ردوکتاز

GCTTGGATCACTGGACAGA

TTAGCGTCTTCCCACCAC

اکتین 2

TGGCATCACACTTTCTACAAC

ACACACCATCACCAGAATC

 


تحلیلآماری: پارامترهای اندازه گیری شده در 4 تکرار بیولوژیکی انجام شد. تجزیه و تحلیل داده ها از طریق نرم افزار آماری  SPSS و جهت ترسیم نمودارها از نرم افزار Microsoft Office Excel استفاده شد. برای مقایسه میانگین تیمارها، ازطرح اماری تصادفی و آزمون واریانس یک سویه و پس آزمون توکی در سطح احتمال یک درصد استفاده شده است.

نتایج

تـاثیرنیتـراتونیترات آمونیومبر پارامترهای رشد: رشد

گیاهچه های کلزا و بروکلی بطور معنی داری در سطح احتمال یک درصد تحت تاثیر نوع ازت عرضه شده قرار گرفته است. نتایج نشان داده است که پارامترهای رشد از قبیل وزن تر و خشک اندام هوایی در هر دو گیاهچه، و همچنین نسبت وزن اندام هوایی به ریشه در گیاهچه های کلزا تحت تاثیر نیترات آمونیوم افزایش معنی داری نسبت به پارامترهای رشد گیا ه رشد یافته در محیط حاوی نیترات داشته است (جدول 2).

 

جدول 2 - تأثیر نیترات و نیترات آمونیوم بر وزن تر و خشک ریشه و اندام هوایی و نسبت اندام هوایی به ریشه در گیاهچه های کلزا و بروکلی.

نیترات آمونیوم

نیترات

 

اندام هوایی

ریشه

اندام هوایی

ریشه

کلزا

55/1 ±12/0 a

24/0 ±05/0 c

79/0 ±08/0 b

19/0 ±06/0 c

وزن تر (گرم)

14/0 ±04/0 a

019/0 ±003/0 c

06/0 ±01/0 b

017/0 ±003/0 c

وزن خشک (گرم)

46/6 ±16/0 a

15/4 ±29/1 b

نسبت  اندام هوایی  به ریشه

 

 

 

 

بروکلی

88/0 ±09/0 a

19/0 ±02/0 c

65/0 ±11/0 b

15/0 ±04/0 c

وزن تر (گرم)

087/0 ±006/0 a

014/0 ±002/0 c

 b05/0 ±068/0

012/0 ±003/0 c

وزن خشک (گرم)

89/4 ±35/1 a

53/4 ±42/0 a

نسبت  اندام هوایی  به ریشه

      میانگین های دارای حروف لاتین غیر مشابه بر اساس آزمون واریانس یک سویه در سطح احتمال یک درصد معنی دار هستند  .(p< 0.01)

 

اگرچه گیاهچه های کلزا از نظر آماری بطور معنی داری در سطح احتمال یک درصد بیشتر از گیاهچه های بروکلی تحت تاثیر منبع متفاوت نیتروژنی قرار گرفته اند. بطوریکه وزن تر و خشک اندام هوایی در گیاهچه های کلزای رشد یافته با نیترات آمونیوم، 2 و  3/2 برابر بیشتر از پارامترهای ذکر شده در گیاهچه های رشد یافته با نیترات بوده است. همچنین نسبت اندام هوایی به ریشه در گیاهان تغذیه شده با نیترات آمونیوم 5/1 برابر بیشتر از گیاهچه های تغذیه شده با نیترات بوده است. درحالیکه وزن تر و خشک اندام هوایی در گیاهچه های بروکلی رشد یافته با نیترات آمونیوم، 4/1 و  2/1 برابر بیشتر از پارامترهای ذکر شده در گیاهچه های رشد یافته با نیترات بوده است. نسبت اندام هوایی به ریشه نیز تفاوت معنی داری بین گیاهچه های بروکلی تغذیه شده با نیترات آمونیوم و نیترات نشان نداد (جدول 2).

تاثیرنیتراتونیترات آمونیومبر محتوای سولفور کل و سولفات: محتوای سولفور کل در اندام هوایی و ریشه گیاهچه های کلزای رشد یافته با نیترات بترتیب 5/1 و 3/1 برابر بیشتر از گیاهچه های بروکلی تغذیه شده با نیترات بود (نمودار 1).

نتایج نشان داد که محتوای سولفور کل در گیاهچه های کلزای تغذیه شده با نیترات آمونیوم و نیترات تفاوت معنی داری از نظر آماری نداشت. در حالیکه در گیاهچه بروکلی تغذیه شده با نیترات آمونیوم، محتوای سولفور کل در اندام هوایی 20 درصد نسبت به گیاهچه های تغذیه شده با نیترات افزایش یافت ولی در ریشه اختلاف معنی داری در محتوای سولفور کل مشاهده نشد ( نمودار 1).

محتوای سولفات در اندام هوایی و ریشه گیاهچه های کلزای تغذیه شده با نیترات آمونیوم بترتیب 50  و 25 درصد کمتر از گیاهچه های تغذیه شده با نیترات بود. در حالیکه محتوای سولفات هم در اندام هوایی و هم در ریشه گیاهچه های بروکلی تغذیه شده با نیترات آمونیوم و نیترات از نظر آماری اختلاف معنی داری نداشت (نمودار 1).


 

نمودار 1 - تاثیر نیترات و نیترات آمونیوم بر محتوای سولفور کل و سولفات در ریشه و اندام هوایی گیاهچه های کلزا و بروکلی. میانگین های دارای حروف لاتین غیر مشابه بر اساس آزمون واریانس یک سویه در سطح احتمال یک درصد معنی دار هستند  .(p< 0.01)


تاثیرنیتراتونیترات آمونیومبر محتوای تیولها و سیستئین: محتوای تیولها و سیستئین در اندام هوایی گیاهچه های کلزای رشد یافته با نیترات به ترتیب 5/1 و 2/1 برابر بیشتر از گیاهچه های بروکلی تغذیه شده با نیترات بود (نمودار 2).

محتوای تیولها در ریشه و اندام هوایی گیاهچه های کلزای تغذیه شده با نیترات آمونیوم بترتیب 25 و30 درصد افزایش نسبت به گیاهچه های تغذیه شده با نیترات نشان داد (نمودار 2). در حالیکه نتایج نشان داد که محتوای تیولها در گیاهچه های بروکلی تغذیه شده با نیترات آمونیوم و نیترات هم در ریشه و هم در اندام هوایی اختلاف معنی داری نداشته است (نمودار 2).

همچنین تغذیه با نیترات آمونیوم باعث افزایش میزان اسید آمینه سیستئین در اندم هوایی هر دو گیاهچه کلزا و بروکلی بترتیب به میزان 40 و 20 درصد نسبت به گیاهچه های تغذیه شده با نیترات شده است (نمودار 2). در حالیکه میزان اسید آمینه سیستئین در ریشه تفاوت معنی داری در هر دو گیاهچه رشد یافته با  نیترات آمونیوم و نیترات نشان نداد (نمودار 2).

 

 

نمودار 2- تاثیر نیترات و نیترات آمونیوم بر محتوای تیولها و سیستئین در ریشه و اندام هوایی گیاهچه های کلزا و بروکلی. میانگین های دارای حروف لاتین غیر مشابه بر اساس آزمون واریانس یک سویه در سطح احتمال یک درصد معنی دار هستند  .(p< 0.01)


تاثیرنیتراتونیترات آمونیومبرمحتوای نیتروژن کل، نیترات و فعالیت آنزیم نیترات ردوکتاز: نتایج نشان داد که محتوای نیتروژن کل، نیترات و فعالیت آنریم نیترات ردوکتاز در هر دو گیاهچه کلزا و بروکلی تغذیه شده با نیترات و نیترات آمونیوم هم در اندام هوایی و هم در ریشه اختلاف معنی داری نداشته است (نمودار 3 و 4).

تاثیرنیتراتونیترات آمونیومبر بیان ژن ناقلین سولفات (ناقلین سولفات 1:1، 1:2، 4:1، 4:2)، آنزیم آدنوزین تری فسفات سولفوریلاز و آدنوزین '5-فسفوسولفات ردوکتاز: بیان ژن هر دو ناقل سولفات 1:1 و 1:2 در اندام هوایی هر دو گیاهچه کلزا و بروکلی بسیار پایین تر از ریشه بوده است (نمودار 5). همچنین نتایج نشان داد که بیان ژن این دو ناقل سولفات در اندام هوایی اختلاف معنی داری را در بین گیاهچه های تیمار شده با نیترات و نیترات آمونیوم نشان نداد (نمودار 5). بهمین ترتیب بیان ژن ناقل سولفات 1:1 در ریشه هر دو گیاهچه، اختلاف معنی داری را در بین گیاهچه های تیمار شده با نیترات و نیترات آمونیوم نشان نداد (نمودار 5). بیان ژن ناقل سولفات 1:2 در ریشه گیاهچه های کلزای تیمار شده با هر دو نوع منبع نیتروژنی بطور معنی داری در سطح احتمال یک درصد بیشتر از بیان ژن یاد شده در گیاهچه های بروکلی بود در حالیکه اختلاف معنی داری در بیان ژن ناقل سولفات 1:2 در بین گیاهچه های تیمار شده با نیترات و نیترات آمونیوم مشاهده نشد (نمودار 5).


 

نمودار 3 - تاثیر نیترات و نیترات آمونیوم بر محتوای نیتروژن کل و نیترات در ریشه و اندام هوایی گیاهچه های کلزا و بروکلی. میانگین های دارای حروف لاتین غیر مشابه بر اساس آزمون واریانس یک سویه در سطح احتمال یک درصد معنی دار هستند  .(p< 0.01)

 

نمودار 4 - تاثیر نیترات و نیترات آمونیوم بر فعالیت آنریم نیترات ردوکتاز در ریشه و اندام هوایی گیاهچه های کلزا و بروکلی. میانگین های دارای حروف لاتین غیر مشابه بر اساس آزمون واریانس یک سویه در سطح احتمال یک درصد معنی دار هستند  .(p< 0.01)


بیان ژن ناقل سولفات 1 :4 هم در ریشه و هم در اندام هوایی اختلاف معنی داری را در بین گیاهچه های کلزا و بروکلی تغذیه شده با نیترات و نیترات آمونیوم نشان نداد.  بهمین ترتیب بیان ژن ناقل سولفات 2 :4 هم در ریشه و هم در اندام هوایی اختلاف معنی داری را در بین گیاهچه های بروکلی تغذیه شده با نیترات و نیترات آمونیوم نشان نداد. در حالیکه بیان ژن ناقل سولفات 2 :4 در ریشه و اندام هوایی گیاهچه های کلزای تغذیه شده با نیترات آمونیوم بطور معنی داری در سطح احتمال یک درصد بیشتر از نیترات بود (نمودار 5).

نتایج نشان داد که نوع تغذیه نیتروژنی اثر معنی داری بر بیان ژن آنزیم آدنوزین تری فسفات سولفوریلاز در اندام هوایی و ریشه هر دو گیاهچه کلزا و بروکلی نداشت. اگرچه بیان این ژن در اندام هوایی کلزای تیمار شده با هر دو منبع نیتروژنی نیترات و نیترات آمونیوم بطور معنی داری در سطح احتمال یک درصد بیشتر از بیان ژن در اندام هوایی گیاهچه های بروکلی بود (نمودار 5). بهمین ترتیب بیان ژن آنزیم آدنوزین '5-فسفوسولفات ردوکتاز در اندام هوایی بروکلی تیمار شده با هر دو منبع نیتروژنی بطور معنی داری بیشتر از بیان این ژن در اندام هوایی بروکلی بود (نمودار 5). همچنین نتایج نشان داد که بیان ژن آدنوزین '5-فسفوسولفات ردوکتاز در اندام هوایی هر دو گیاهچه تغذیه شده با نیترات آمونیوم بطور معنی داری در سطح احتمال یک درصد بیشتر از نیترات بود. بهمین ترتیب بیان ژن آدنوزین '5-فسفوسولفات ردوکتاز در ریشه گیاهچه های کلزای تغذیه شده با نیترات آمونیوم بطور معنی داری بیشتر از نیترات بوده در حالیکه در ریشه گیاهچه های بروکلی اختلاف معنی داری مشاهده نشده است (نمودار 5).

 

 

نمودار 5- تاثیر نیترات و نیترات آمونیوم بر بیان نسبی ژن ناقلین سولفات (ناقلین سولفات 1:1، 1:2، 4:1، 4:2)، آنزیم آدنوزین تری فسفات سولفوریلاز و آدنوزین '5-فسفوسولفات ردوکتاز در در اندام هوایی (بالای محور x) و ریشه (پایین محور x) گیاهچه های کلزا و بروکلی. سطح نسبی رونویسی ژنهای هدف در مقایسه با ژن اکتین 2 به عنوان ژن رفرنس با 4 تکرار مستقل بیولوژیکی RNA استخراج شده از اندام هوایی و ریشه مورد اندازه گیری قرار گرفت. سطح نسبی رونویسی ژن هدف، از تفریق بیان ژن اکتین 2 از بیان ژن هدف به دست آمده است. میانگین های دارای حروف لاتین غیر مشابه بر اساس آزمون واریانس یک سویه در سطح احتمال یک درصد معنی دار هستند  .(p< 0.01)


بحث و نتیجه گیری

نیتروژن از عناصر مهم محلولهای غذایی گیاهی بوده که اثرات آن بر رشد، فیزیولوژی، عملکرد و کیفیت تولیدات گیاهی به دو عامل غلظت و نوع منبع نیتروژنی بستگی دارد (4، 8). با وجود اینکه نیترات (منبع غالب نیتروژن) پس از جذب توسط گیاه و قبل از ورود به ترکیبات آلی به آمونیوم احیا می شود ولی که اگر تنها منبع نیتروژن گیاه آمونیوم باشد، بافت های آوندی گیاه تخریب می شود و در نهایت، جذب آب را محدود خواهد کرد. همچنین کاهش کربوهیدرات ها، کاهش فتوسنتز و افزایش تنفس ریشه نیز بر اثر مصرف آمونیوم بیش از نیاز گیاه دیده می شود (5).

مطالعات نشان داده است که کاربرد خارجی هر دو منبع نیتروژنی نیترات و آمونیوم با یک نسبت مناسبی تاثیر متفاوت و یا بهتری بر رشد گیاه داشته باشد. در مقایسه بین تغذیة نیترات آمونیوم و نیترات کلسیم، در گیاه  Euphorbia pulcherrimaتغذیه شده با نیترات آمونیومی ارتفاع گیاه افزایش یافته (20)  و با کاهش تغذیه آمونیومی نسبت به تغذیة نیتراتی ارتفاع گیاه، تعداد گره ها و وزن خشک شاخه ها کاهش یافته است (23). در مطالعه حاضر نیز افزایش در میزان وزن تر و خشک اندام هوایی و همچنین افزایش نسبت اندام هوایی به ریشه در نسبت مساوی آمونیوم به نیترات در مقایسه با تغذیه نیتراتی مشاهده شده است. این نتیجه در تطابق با یافته های بیبوردی و همکاران در سال 2010 می باشد که تاثیر نسبتهای مختلف نیترات به آمونیوم را در گیاه کلزا مطالعه کردند (16).  میزان وزن تر و خشک اندام هوایی در تحقیق حاضر می تواند به دلایلی از قبیل افزایش سطح برگی ناشی از افزایش فعالیت آنزیم سیتوکینین سنتاز (29)، افزایش محتوای نسبی آب گیاه، محتوای پتاسیم برگ و همچنین افزایش میزان فتوسنتز و تنفس در نسبت مساوی آمونیوم به نیترات در مقایسه با تغذیه نیتراتی افزایش یافته باشد (17). از طرفی دیگر، با توجه به جذب آسانتر آمونیوم توسط گیاه رشد سریعتر گیاه در تغذیه مساوی آمونیوم به نیترات نسبت به تغذیه نیتراتی  قابل انتظار خواهد بود. علاوه بر این افزایش معنی دار فعالیت آنزیمهای چرخه کالوین مانند روبیسکو،  گلیسرآلدهید 3- فسفات دهیدروژناز، آلدولاز، فروکتوز1و 6 بیس فسفاتاز، ترانس کتولاز، فسفوریبولوکیناز، در نسبت مساوی آمونیوم به نیترات (10 میلی مولار) نسبت به تغذیه نیتراتی (20 میلی مولار) در غلظت یکسان نیتروژن در گیاه تنباکو گزارش شده است (24) که کارایی بالای فرایند فتوسنتز و تاثیر مثبت آن بر رشد در گیاه تغذیه شده با نسبت مساوی آمونیوم به نیترات را نشان می دهد. همچنین استفاده از نسبت مناسب و متعادلی از نیتروژن آمونیومی به نیتروژن کل در محلول های غذایی سبب افزایش درصد نیتروژن برگی و بهمین ترتیب افزایش نسبی رشد و بهبود قابل توجه ویژگی های کمی و کیفی گیاه بنت القنسول شده است (7). هنگامی که گیاه از نیتروژن کافی برخوردار باشد، سرعت فتوسنتز افزایش یافته و گیاه را قادر میسازد که سریعتر رشد نماید و زیست توده بیشتری تولید کند (1، 10). اگر چه میزان نیتروژن کل و نیترات و همچنین فعالیت آنزیم نیترات ردوکتاز در هر دو گیاه رشد یافته در محلول غذایی حاوی نسبت مساوی آمونیوم به نیترات نسبت به تغذیه نیتراتی اختلاف معنی داری نشان نداد (نمودار3 و 4).

علاوه بر نیتروژن، عنصر سولفور و یا ترکیبات آلی سولفور دار مانند اسیدهای آمینه سولفوردار (متیونین و سیستئین) و پروتئین نیز از عوامل مهم و تاثیر گذار بر رشد گیاهان محسوب می شوند. همانطور که نتیجه تحقیق حاضر نشان داده است، افزایش وزن تر و خشک و رشد ساقه هر دو گیاه کلزا و بروکلی و همچنین ریشه کلزای رشد یافته در محلول غذایی حاوی نسبت مساوی آمونیوم به نیترات با افزایش میزان کل ترکیبات آلی سولفور دار که از تفریق میزان کل سولفور از میزان کل سولفات اندام ها محاسبه شد، همراه بوده است. همچنین میزان ترکیبات آلی سولفور دار از قبیل میزان تیولها (ترکیبات آلی سولفودار غیر پروتئینی محلول در آب که از مهمترین آنها گلوتاتیون می باشد) در اندام هوائی و ریشه کلزا و میزان اسید آمینه سیستئین در اندام هوایی کلزا و بروکلی رشد یافته در محلول غذایی حاوی نسبت مساوی آمونیوم به نیترات بطور معنی داری بیشتر از میزان تیولها و سیستئین در اندام های ذکر شده هر دو گیاه رشد یافته در محلول غذایی حاوی نیترات بوده است (نمودار 2). به همین ترتیب افزایش بیان ژن آدنوزین '5-فسفوسولفات ردوکتاز در تطابق با افزایش سنتز تیولها و سیستئین در اندام هوایی هر دو گیاه کلزا و بروکلی رشد یافته در نیترات آمونیوم بوده است و در واقع حکایت از اهمیت و نقش کلیدی این آنزیم در تبدیل سولفات به ترکیبات آلی سولفور دار در محیط رشد حاوی نیترات آمونیوم نسبت به نیترات  نیز دارد. افزودن آمونیوم به محیط کشت گیاه عدسک آبی (Lemna minor)نیز میزان احیای سولفات را به دلیل افزایش فعالیت آنزیم آدنوزین '5-فسفوسولفات ردوکتاز ، افزایش داده است (14). بطور مشابه ای، میزان فعالیت آنزیم آدنوزین '5-فسفوسولفات ردوکتاز در دو گونه تنباکو رشد یافته در محیط حاوی نیترات آمونیوم بیشتر از فعالیت آنزیم در گیاه رشد یافته در محیط حاوی نیترات بود (38). علاوه بر فعالیت آنزیم، بیان ژن ایزوفرم های مختلف آدنوزین '5-فسفوسولفات ردوکتاز در آرابیدوپسیس تالیانا با افزودن آمونیوم به محیط رشد گیاه افزایش یافت (37). علی رغم میزان ترکیبات آلی سولفور دار، میزان کل سولفور اختلاف معنی داری را در بین گیاهان رشد یافته در محلول غذایی حاوی نیترات آمونیوم نسبت به تغذیه نیتراتی نشان نداد که البته با عدم تغییر بیان ژن ناقلین سولفات 1:1 و 1:2 در ریشه همراه بود. این ناقلین سولفات متعلق به گروه 1 سولفات ترانسپورتر، دارای تمایل بالایی به سولفات بوده و عمدتا در سلولهای ریشه بیان می شوند (28). اما میزان سولفات در ریشه واندام هوایی گیاه کلزا تغذیه شده با نیترات آمونیوم بطور معنی داری کاهش یافت (نمودار1). سولفات در ارگانل واکوئل اندام هوایی و ریشه گیاه ذخیره می شود (28) و افزایش بیان ژن ناقل سولفات 4:2 در مواجهه گیاه با نیترات آمونیوم باعث خروج بیشتر سولفات از واکوئل به سیتوپلاسم شده و سپس سولفات وارد مسیر احیای سولفور جهت تولید ترکیبات آلی سولفوردار گردیده است.

در هر دو گیاه، ارتباط مستقیم بین میزان سولفور کل و همچنین ترکیبات آلی سولفوردار با بیان ژنهای ناقل سولفات و آنزیمهای که در احیای سولفات به ترکیبات آلی سولفور دار نقش دارند، وجود دارد. بطوریکه در گیاه کلزا که به دلیل تجمع بالاتر سولفور کل و سنتز بیشتر تیول و سیستئین بخصوص در اندام هوائی احتمالا نیازمندی بیشتری در جذب سولفات نسبت به بروکلی وجود دارد، ناقل سولفات 1:2 و آنزیم آدنوزین '5-فسفوسولفات ردوکتاز در کلزا از بیان بالاتری نسبت به بروکلی برخوردار می باشند.

نتیجه گیری کلی

نوع تغذیه نیتروژنی در رشد و متابولیسم سولفور در گیاهان خانواده کلم دارای اهمیت می باشد. کاربرد خارجی نسبت مساوی از نیترات و آمونیوم دارای اثر مثبت معنی داری در سطح احتمال یک درصد بر رشد گیاهان کلزا و بروکلی بوده است. این اثر مثبت نیترات آمونیوم بر رشد اندام هوایی در گیاه کلزا که نیازمندی بالاتری به جذب سولفور و سنتز ترکیبات آلی سولفوردار دارد، بیشتر از بروکلی مشاهده شده است. سولفور و ترکیبات الی سولفوردار دارای اهمیت بالایی در رشد گیاهان می باشد و تاثیر مثبت نیترات آمونیوم بر رشد گیاه نیز از طریق تحریک بیان ژن ناقل سولفات 4:2 و آنزیم درگیر (آدنوزین '5-فسفوسولفات ردوکتاز) در احیای سولفات به تیولها و اسید آمینه سیستئین همراه بوده است.

 

 

1- حسامی، ر.، و شریعتی، م. 1393. پاسخ شاخص کارایی فتوسنتزی(PIABS) نسبت به کمبود نیترات در گیاهان تنباکو (Nicotiana plumbaginifolia) تراریخته شده با ژن ناقل نیتراتAtNRT  با استفاده از فلئورسنس کلروفیلa. مجله پژوهشهای گیاهی، 27 (4): 579-569.

2- حسنی، ا.، و نورزاده حداد، م. 1395. تأثیر نیترات آمونیوم و اسیدهای آمینه آزاد بر تجمع نیترات در تربچه قرمز، نشریه دانش آب و خاک، 67 :78-26

3- سپهری، ع.، مدرس ثانوی، س.ع.م.، قره یاضی، ب.، و یمینی، ی. 1381. اثر تنش آب و مقادیر مختلف نیتروژن بر مراحل رشد و نمو ، عملکرد و اجزای عملکرد ذرت. مجله علوم زراعی ایران، 4 (3): 195-184.

4- سید شریفی، ر.، و ضعیفی زاده، م. 1392. تأثیر مصرف نیتروژن بر عملکرد دانه، فیلوکرون و سرعت ظهور برگ سه رقم ذرت. مجله پژوهشهای گیاهی، 26 (2): 207-196.

5- کافی، م.، لاهوتی، ع.، شریفی، م.، و گلدانی، م. 1384. فیزیولوژی گیاهی، انتشارات جهاد دانشگاهی مشهد، 350.

6- عابدینی، م. 1393. نقش آمونیوم به عنوان عامل تنش زا در گیاه نیترات پسند چغندر قند، فیزیولوژی تنش گیاهان، 1: 34-25.

7- مشرفی عراقی، ع.، نادری، ر.، بابالار، م.، طاهری، م. 1392. اثر نسبت های مختلف نیتروژن آمونیومی به نیتروژن کل بر رشد رویشی و گل دهی گیاه گلدانی بنت القنسول (Euphorbia pulcherrima)، به زراعی کشاورزی، (3)15: 51-39.

 

8- Agbaria, H., B. Heure and N. Zieslin. 1996. Shoot-root interaction effects on nitrate reductase and glutamine synthetase activities in rose graftlings. Journal of plant physiology, 149: 559-563.

9- Aghajanzadeh, T., M.J. Hawkesford and L.J. De Kok. 2014. The significance of glucosinolates for sulfur storage in Brassicaceae seedlings. Frontiers in Plant Science, 5: 704.

10- Ashraf, M and Q. Ali. 2005. The effect of applied nitrogen on the growth and nutrient concentration of Kalonji (Nigella sativa). Australian Journal of Experimental Agriculture, 45: 459-463.

11- Balkos, K.D., D.T. Britto, H.J. Kronzucker. 2010. Optimization of ammonium acquisition and metabolism by potassium in rice (Oryza sativa L. cv. IR-7) plant. Cell and Environment33: 23–34.

12- Bierman, P.M., C. Rosen and H.F. Wilkins. 1990. Leaf edge burn and auxillary shoot growth of vegetative poinsettia plants; influence of calcium, nitrogen form, and molybdenum. Journal of the American Society for Horticultural Science, 115(1): 73-78.

13- Boodley, J.W. 1971. Nitrogen fertilizer and their influence on the growth of poinsettia. New York state Flower Ind Bul, 10: 4-7.

14- Brunold, C and M. Suter. 1984. Regulation of sulfate assimilation by nitrogen nutrition in the duckweed Lemna minor L. Plant Physiology, 76: 579–583.

15- Buchner, P., S. Parmar, A. Kriegel, M. Carpentier and M.J. Hawkesford. 2010. The sulfate transporter family in wheat: tissue-specific gene expression in relation to nutrition. Molecular Plant, 3: 374-389.

16- Bybordi, A., J. Tabatabaei and A. Ahmadov. 2010. Effect of different ratios of nitrate to ammonium on photosynthesis, respiration and antioxidant enzymes activity in canola (Brassica napus L.) in saline conditions. Iranian Journal of Field Crops Research, 8 (6): 975 982.

17- Bybordi, A. 2012. Effect of different ratios of nitrate and ammonium on photosynthesis, and fatty acid composition of canola under saline conditions. International Journal of Agriculture and Crop Sciences, 4 (10): 622-626.

18- Chance, O.W., Z.C. Somda, H.A. Mills. 1999. Effect of nitrogen form during the flowering period on zucchini squash growth and nutrient element uptake. Journal of Plant Nutrition, 22: 597-607.

19- Claussen, W and F. Lenz. 1999. Effect of ammonium or nitrate nutrition on net photosynthesis, growth and activity of the enzymes nitrate reductase and glutamine synthetase in blueberry, raspberry and strawberry. Plant and Soil, 208: 95-102.

20- Cox, D.A and J.G. Seedley. 1984. Ammonium injury to poinsettia: Effect of NH4-N: NO3-N ratio and pH control in solution culture on growth, N absorption and N utilization. Journal of the American Society for Horticultural Science, 109: 57-64.

21- De Kok, L.J., F. Buwalda and W. Bosma. 1988. Determination of cysteine and its accumulation in spinach leaf tissue upon exposure to excess sulfur. Journal of Plant Physiology, 133: 502-505.

22- Dordas, C.A and C. Sioulas. 2007. Safflower yield, chlorophyll content, photosynthesis, and water use efficiency response to nitrogen fertilization under rain fed conditions. Industrial Crops and Products, 27: 75-85.

23- Gaffney, J.M., R.S. Lindstrom, A.R. Mc Daniel and A.J. Lewis. 1982. Effect of Ammonium and Nitrate Nitrogen on Growth of Poinsettia. Hortscience, 17(4): 603-604.

24- Geiger, M., V. HaakeF. LudewigU. Sonnewald and M. Stitt. 1999. The nitrate and ammonium nitrate supply have a major influence on the response of photosynthesis, carbon metabolism, nitrogen metabolism and growth to elevated carbon dioxide in tobacco. Plant, Cell and Environment, 22: 1177-1199.

25 - Gigolashvili, T and S. Kopriv, S. 2014. Transporters in plant sulfur metabolism. Frontiers in Plant Science. 5: 442.

26-Girardin, P., M. Tollenaar, A. Deltour, and J. Muldoon. 1987. Temporary N starvation in maize (Zea mays L.): effcets on development, dry matter accumulation and grain yield. Agronomie (Paris), 7: 289-296.

27- Hartman, P.l., A. Harry and J. Benton. 1986. The influence of nitrate: Ammonium Ratios on growth, Fruit development and element concentration in "Floral" Tomato plant. Journal of the American Society for Horticultural Science, 111(4): 487-490.

28- Hawkesford, M.J and L.J. De Kok. 2006. Managing Sulphur metabolism in plants. Plant Cell Environment, 29:382–395.

29- Hawkins, H.J and O.A.E. Lewis. 1993. Effect of NaCl Salinity, nitrogen form, calcium and potassium concentration on nitrogen uptake and kinetics in Triticum aestivum. L. CV. Gamtoos. New Phytologist, 124: 171-177.

30- Hopper, D.A. 1996. High pressure sodium radiation during off-peak night times increases cut rose production and quality. HortScience, 31:938-940.

31- Hrivna, L., R. Richter, T. Losak and J. Hlusek. 2002. Effect of increasing doses of nitrogen and sulphur on chemical composition of plants, yields and seed quality in winter rape. Rostlinna Vyroba, 48: 1-6.

32- Inala, A and Tarakcioglua, C. 2001. Effects of nitrogen forms on growth, nitrate accumulation, membrane permeability, and nitrogen use efficiency of hydroponically grown bunch onion under Boron deficiency and toxicity. Journal of Plant Nutrition, 24: 1521-1534.

33-Jones, J.B. 1995. Determining total sulphur in plant tissue using the HACH kit spectrophotometer technique. Sulphur Agriculture. 19: 58-62.

34- Jose, R and G.E. Wilcox. 1984. Growth, free amino acid, and mineral composition of tomato plants in relation to nitrogen form and growing media. Journal of the American Society for Horticultural Science, 109(3): 406-411.

35-Kjeldahl, J. 1883. New method for the determination of nitrogen in organic substances. Zeitschrift für analytische Chemie, 22 (1): 366-383.

36- Kopriva, S and H. Rennenberg. 2004. Control of sulphate assimilation and glutathione synthesis: interaction with N and C metabolism. Journal of Experimental Botany, 55: 1831–1842.

37- Koprivova, A., M. Suter, R.O.D. Camp, C. Brunold and S. Kopriva. 2000. Regulation of Sulfate Assimilation by Nitrogen in Arabidopsis. Plant Physiology, 122: 737-746.

38- Kruse, J., S. Koprival, R. Hansch, G.J. Krauss, R.R. Mendel and H. Rennenberg. 2007. Interaction of Sulfur and Nitrogen Nutrition in Tobacco (Nicotiana tabacum) Plants: Significance of Nitrogen Source and Root Nitrate Reductase. Plant Biology. 9: 638–646.

39- Leustek, T and K. Saito. 1999. Sulfate transport and assimilation in plants. Plant Physiology, 120: 637–644.

40- Leustek, T., M.N. Marin, J.A. Bick and J.P. Davies. 2000. Pathways and regulation of sulfur metabolism revealed through molecular and genetic studies. Annual Review of Plant Physiology and Plant Molecular Biology, 51: 141–165.

41- Maas, F.M., I. Hoffmann, M.J. Van Harmelen and L.J. De Kok. 1986. Refractometric determination of sulphate and other anions in plants separated by high-performance liquid chromatography. Plant and Soil, 91: 129-132.

42- Migge, A., C. Bork, R. Hell and T.W. Becker. 2000. Negative regulation of nitrate reductase gene expression by glutamine or asparagines accumulating in leaves of sulfur-deprived tobacco. Planta, 211: 587–595.

43-Page, A. 1986. Methods of Soil Analysis. Part: 2, Chemical Methods. 2nd Edition. Soil Science Society of America, 1188.

44- Prosser, I. M., J.V. Purves, L.R. Saker and D.T. Clarkson. 2001. Rapid disruption of nitrogen metabolism and nitrate transport in spinach plants deprived of sulphate. Journal of Experimental Botany, 52: 113–121.

45- Reuveny, Z., D.K. Dougall and P.M. Trinity. 1980. Regulatory coupling of nitrate and sulfate assimilation pathways in cultured tobacco cells. Proceedings of the National Academy of Sciences of the USA, 77: 6670–6672.

46- Smith, I. K. 1980. Regulation of sulfate assimilation in tobacco cells. Effect of nitrogen and sulfur nutrition on sulfate permease and O-acetylserine sulfhydrylase. Plant Physiology, 66: 877–883.

47-Takahashi, H and K. Saito. 1996. Subcellular localization of spinach cysteine synthase isoforms and regulation of their gene expression by nitrogen and sulfur. Plant Physiology, 112: 273-280.

48- Tausz, M and L.J. De Kok, I. Stulen and D. Grill. 1996. Physiological responses of Norway spruce trees to elevated CO2 and SO2. Journal of Plant Physiology, 148: 362-367.

49- Verwoerd, T.C., B.M. Dekker and A. Hoekema. 1989. A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Research, 17: 23-62.

50- Widmer, R.E. 1953. Nutrient stadies with the poinsettia. Proceedings of the American Society for Horticultural Science, 61:508-514.

51- Wong, M.L and J.F. Medrano. 2005. Real-time PCR for mRNA quantitation. Biotechniques, 39:75-85.